Pop Joven México

Biografía de James Maslow

Categorías: Big Time Rush, Biografías, Destacados, James Maslow
Escrito por: popjoven

James Maslow nació el 16 de julio de 1990 en New York, Estados Unidos; hijo de Cathy Burge y Mike Maslow, inició su carrera como cantante a la edad de 6 años, participaba en obras de teatro en la escuela, posteriormente se incorporó al elenco de la serie de Nickelodeon “Big Time Rush” y en donde actualmente forma parte de la banda con el mismo nombre a lado de Carlos Peña Jr., Kendall Schmidt y Logan Henderson,

Dentro de su trabajo como actor se encuentran participaciones en series como “iCarly” y “Big Time Rush” como y en la película “UrFrenz”.

Debes saber que su signo zodiacal es Cáncer, le encantan los deportes sobre todo el surf, baloncesto, beisbol y futbol; su color favorito es el verde, tiene un perrito como mascota llamado Falco, le encantan los caballos y la equitación; su segundo nombre es David pero prefiere que lo llamen James. Su libro favorito es “El Juego de Ender” y su grupo favorito es “Maroon 5”. Tiene una cicatriz en el codo que se hizo durante la primera grabación de “Big Time Rush”.

Comparte este artículo

1,335 Comentarios a “Biografía de James Maslow”

  1. esme Dice:

    q wapo esta!!!!
    y q curioso q tngamos cosas en comun

  2. perla Dice:

    te amo james estas gupisimo

  3. PAOLA Dice:


  4. PAOLA Dice:


  5. F@nny Dice:

    AY estas mega iper wapo

    TE AMO!!!!!


  6. rebeca Dice:

    eres suuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuper guapo

  7. guiitha Dice:

    ermoso rickooo te amooo

  8. Ariadna Dice:

    Q lindo es James!!!!!!!!
    No voy a decir q tengo cosas en común, lo único es q me gusta la música y la actuación, y el verde es mi 3 color favorito!!! Pero no voy a decir q todo lo demás me gusta xq no es verdad, y estoy segura q algunas dicen q tienen todo en común xq pienzan q con eso van a lograr algo, pero no es así!!!
    En fin… James: Sos re lindo!!!!!xD

  9. Ariadna Dice:

    Me encanta como cantás y como actuas!!!! Espero q el cd de Big Time Rush llege pronto a Argentina!!!!!!!!!!
    Te amo!!!xD

  10. hila Dice:

    james tenemos tantas cosas en comun y eres mega guapo te amo!!!

  11. mariana Dice:

    i love james you never say never ilove

  12. karen Dice:

    esta guapisimo guapisimo
    lindisimo lindisimo
    hermosisimo hermosisimo y tambien eres todo lo demas ke sea bello

  13. lea Dice:


  14. l@ur@ Dice:

    james tenemos muchisimas cosas en comun por ejemplo:
    mi color favorito es el verde
    me gustan los caballos
    la musica
    soy muy linda y pienso k eres muy guapo
    pliss bengan a mexico al estado de guadalajara

  15. MaomiD'JonasMaslow Dice:

    me gustaria
    conoserte :$

    I ♥ U

  16. Janeth Maslow Dice:

    tE amO de masiadO!!!!!! nO puEdE habEr alguiEn mEjOr qE tu………..EspErO cOnOcErtE algun dia

  17. karoll Dice:

    teeeeeeeeee aaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmoooooooooooooooo mmmmmmmmmmmuuuuuuuucccchhhhhhhhooooooooooooooooooooooooo

  18. Anna Dice:

    Todas están muy mal por que james es solo mío …. Yo soy su fan numero 1 y lo amooo .es el mejor y me casare con el vengan a Mérida yucatan plis los te amo <3

  19. laura Dice:


  20. jazmin Dice:

    te amo eres para mi y solo para mi muacc qieres ser mi novio??

  21. elizabeth Dice:

    hola james te quiero decir que te amo mucho mas que ninguna pendeja que a escrito a qui ers muy lindo te amo y escuchen pendejas de mierdes james es mio solo mio y para nadie mas escucharos bueno james te amo y espero que vengan a tucuman los amo la mas linda de todas las que an escrito aqui

  22. selena Dice:

    james eres elmas guapo y te adoro mucho y busco novio y soy sdoltera y te dejo my numero de cel 4448019338

  23. brenda de james Dice:

    uuuuuuuf I love james estaaz super guapoo komo me encantaria ke binieras a mexico – monterrey paa verte a personaa TE AMOO! james

  24. brenda de james Dice:

    james the dejo mi numero 8180275605

  25. brenda de james Dice:

    aa no lo siento eske ese numero ya me lo kancelaron

  26. brenda de james Dice:

    mi numero real es: 8569642526

  27. brenda de james Dice:

    mira elizabeth tuu no erez nadiee para decirnoz pendejaz azsi kee mejor kallate y no digaz nadaa porke todaz somoz perzonaz nadie es lo maximo y aparte lo siento mucho porke se ke tu no erez nada para james ni yo tampoco azi kee mejor kallathee y lo digo denuevo TU NO ERES NADIE PA DECIRNOZ PENDEJAZ NOSOTRAS TAMBIEN AMAMOZ A JAMEZ Y KEE KEE TE BALGAA VERGA NO!!! lo siento por laz palabraz pero0o es laa verdad!

  28. brenda de james Dice:

    I love jaamees!

  29. lupita Dice:

    james estas bn guapo bb estas como quieres

  30. bioleta Dice:

    elizabet es una pendega esta drogada el es solo mio soy su fan numero uno mi amiga lo conose y me lo ba a presentar jajajaja gracias brenda de james aci se abla yo tambien lo ammmmooooooo como todas menos elizabet

  31. Nancy Dice:

    I Love You james (:

  32. sasi Dice:

    james eresmuy guapo

  33. caramashme a Dice:

    eres re guuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuapo te amooooooooooooooooooooooooooooooooooooooooooo

  34. sasi Dice:

    te amo mucho mas que cualquiera que escriba aqui te amoooooooooooooooooooooooooo y eres el mas guapo de btr

  35. PAU Dice:

    james esta del asco no se qee le ven

  36. almi Dice:

    hola,bueno la berdad más que por mi estoy aqui por mi amiga laura elle te admira y yo tambien de echo no nombrare las cosas lindas k tu tienes pork son demasiadas y quiero comenarte(a james) que el cabello de la lauri sigue al tullo y va a acer lo que se para ser tufan nuemero1 y porfi que BIG TIME RUSH (LOS MÁS LINDOS DEL UNIVERSO) vengan a chile BY.

  37. almi Dice:

    la laura me va a matar

  38. laura Dice:

    hola amo a james y tenemos muchas cosas en comun

  39. almi Dice:

    oye elizabeth la que dice que somos pendejasde mierda pues tu lo eres

    perdon por eso pero asi la vida

  40. kelly Dice:

    tee amoo james te kiero mas ke jorge

  41. vanessa Dice:

    te amo mucho mas q kendal

  42. arely Dice:

    no manches esta guapisimo me muero x conocerlo y abrazarlo y besarlo
    esta echo todo un cuero.

  43. dani alias la anto Dice:

    hasi que la proncima vez que le busque un nombre le pondre falco no esierto ja..ja..ja…ja…ja.. pero algo que lesdigo es que amo a james estas echo un bombom….

  44. adriana henriquez Dice:

    que linnnndoooo jamess puu esta bien bueno!!! lo amo

  45. Jasmin Dice:

    Dejen De Hacerse Cosas Se que nada De Eso Ustedes Lo Tienen En Comun Con El No Hagan Cuentos Ademas Ustedes Si Son Brutas James David Maslow No Es quien Lo Publica Asi Que Dejen De Estar Poniendo Comentarios Como Si Fuera El Ademas Es Cierto Lo Que Dicen James Es Bello Hermoso Pero Es Mio Y Nadie Me Lo Kitara Vallanc Con Su Justin Bieber El Es Su Amor Y James El Mio Asi K Bye Bye! Hasta La Vista!

  46. Jasmin Dice:

    Dejen De Hacerse Cosas Se que nada De Eso Ustedes Lo Tienen En Comun Con El No Hagan Cuentos Ademas Ustedes Si Son Brutas James David Maslow No Es quien Lo Publica Asi Que Dejen De Estar Poniendo Comentarios Como Si Fuera El Ademas Es Cierto Lo Que Dicen James Es Bello Hermoso Pero Es Mio Y Nadie Me Lo Kitara Vallanc Con Su Justin Bieber El Es Su Amor Y James El Mio Asi K Bye Bye! Hasta La Vista!
    Att: Dominican Republic

  47. jenny Dice:

    james eres mega lindo yo thengo algo en komun kon tigo a mi tambien me gusta la musik en especial la tuya espero konocerthe algun dia

  48. jenny Dice:

    la netha yo estoy de akuerdo kon brenda elizabeth no tiene el derecho de decirnos pendejaz

  49. princesita de james (jenny) Dice:


  50. evelyn Dice:

    hi james just want to know and give me your autographan or just a picture bi time rush and my dream is to be your girlfrient or just a friend i would love to finaly meet big time rush and are super cute….

    oh yeah

  51. ciara Dice:

    wow es tannn lindooo !!! lo amoo

  52. marina Dice:

    eres el mejor de todos nunca me pierdo big time rush eres muy guapo porfavor ven a mexico a guanajuato porfa ven por q mi sueño es conoserte adoro tu musica te adoro ati eres un muchacho mas guapo del mundo entero saludos a todos los de big time rush te amo james

  53. fernanda Dice:

    the amoO james eres mega lindo me enkanthe tu voz en el video de boyfren yo si me uviera suvido kontigo en vez de la planta P.D theamo espero konocerthe algun dia the amoo muxo

  54. mabel reyes Dice:

    l love james forever

  55. perla Dice:

    ojala y vinieran a baja califonia norte lo amo tanto no me pierdo sus episodios aunque sean repetidos

  56. vane Dice:

    es tan lindo lo amo y solo por el me ire a estados unidos y tenemos todo en comun…aparte que es muy lindo y nos gustan las misma cosas :D te amo james maslow

  57. laura Dice:

    me encanta este chavo se ve que es buena onda y ademas se ve super tierno me encantaría conocerlo algún día, estaría padre, me gustaría convertirme en su amiga por que pace un chavo sur relax y divertido

  58. anggie Dice:

    q curioso q james y yo tengamos tantas cosas en comun nos gusta el mismo color verde y tambien me gusta la musica de maroon5
    porfaA ven a ecuador te lo juro de q te quiero conocer, te amo james maslow

  59. Ximena Dice:

    Estas bien guaperrimo¡Te amoooooooooooooooooooo!
    Y yo soy un signo antes que tu y mi color
    favorito es el verde y ya ten go el disco de

  60. valentina Dice:

    eres super lindo y me encanta q estes en el programa todos los dias me veo big time rush nunca me lo piierdo…

  61. alondra Dice:

    jame se que no me conoses pero solo hay algunas cosas en las que nos paresemos por ejemplo:me gustan los caballos,el basquet y el fut pero el color verde casi no me gusta pero bueno yo no soy mentirosa pero se guardar muchos secretos

  62. LUCESITA Dice:


  63. maryorit Dice:

    te amo james

  64. maryorit Dice:

    te amo un monton desde que te conosi
    y maricella tambien te ama besos

  65. natalia Dice:

    te amooo james! <3

  66. eiza f Dice:

    me encata

  67. aranza lizeth Dice:

    james maslow eres completamente guapo ke bueno ke te guste el color verde como a mi me gusta como cantas y actuaz te admiro mucho

  68. katherine Dice:

    me encantaria q big time rush diera un concierto en la republica dominicana por q tienen muchisimas fans aqui. YOU ARE AWESOME

  69. natY Dice:


  70. rociiiio maslow henderson Dice:

    james es el chico mas hermoso del mundo.es talentoso,inteligente,gracioso y lindo a la vez.el que diga que es gay o feo se las vera conmigo y con mi club de fans de BTR.

  71. rociiiio maslow henderson Dice:


  72. jamesiita Dice:


  73. alisson Dice:

    i loveeeeeeeeeeeeeeeee
    you are handsome

  74. alisson Dice:

    i loveeeeeeeeeeeeeeeeeeeeeeeeeeeeee you …you arer handsome

  75. alisson Dice:

    i love you ……you are handsome plis come in bolivia

  76. yesenia Dice:

    hola james eres guapisiiiiiiiiiiiiiiimo la verdad te pareces mucho a otro idolo mio zac efron pero en mejorado espero q hagan una gira por latinoamerica soy de ecuador y me encanta su grupo por fis los amo mua besitos

  77. tg Dice:

    james es muyyyyyyyyyyy pero muyyyyyyy sexi junto con nick jonas y jason dolley en cambio justin es joto

  78. Libny Dice:

    Eres super lindo y guapo y la casualidad es k nacimos la misma fecha y el mismo mes y somos el mismo signo

  79. gabriela guadalupe Dice:

    A mii james masloOw se me hace el hombre mas guapisimo del planeta
    y tambien me gusto mas cuando salio en hay carli esepto por la parte de que ellas tratan de besarlo esa vez me dieron ganas de aorcarlas y desirles el es mio y en cambioo justin inberve es gay lo odio

  80. silvia Dice:

    ola me encanta james david maslow te AMO T.K.M te amo mi amor

  81. valeria Dice:

    james tte aamoo mme quiiero casarr coonn tiigo ttteeee ammooo <3

  82. jessica Dice:

    tenemos cosas en comun te admiro mucho eres para mi el mas lindo de big time rush

  83. jessica Dice:

    tenemos cosas en comun , te admiro muchisisimo , para mi y mis amigas eres el mas lindo de big time rush

  84. angelica Dice:

    hoy es 16 de julio y james maslow cumple 21años hoy.Happy Brithey james¡¡¡

  85. yizeth Dice:

    Hoy cumple años James Maslow 21años pero sigue guapo Happy Britney James eres lo maximo <3 para ami y ami mejor amiga eres el mas guapo de todos y mas guapo k justin bieber y como k cuando ablan de ti me desmayo y

  86. esmy Dice:

    esta guapisisisisisisisisisisimo quisiera estar con el todo el tiempo preferiblemente (toda la vida) su cabello me encanta me gustaria tenerlo haci pero q voy hacer Diosito me hizo haci

  87. esmy Dice:

    yo te admiro aunque you live in EE.UU. and me in Honduran my birthday is in july 28th, 12 days after you if you read this message i will want that you can write to me happy birthday Esmy but only if you want, if you din’t want no matter if you don’t want what can i do? and if you want write in this web page happy 21st birthday a and you was pretty child only fat but you was pretty

  88. nicole Dice:

    james soy tu fan num 1te kiero preguntar si alguna vez big time rush podria hacer un concierto aqui en rep dominicanaoye y te quiero decir k no puedo negar k eres guapisimoooooooooooooooooooooooo te amo te adoro eres el amor de mi vida cuidate besos bye

  89. nicole Dice:


  90. nicole Dice:


  91. PriscilaMaslow Dice:

    Maslower ? :D
    PD : Unanse en Face ami Page James Maslow Te amamos! :Ñ

  92. nicole Dice:

    me encantaria oye eres una genia
    para priscila maslow

  93. mayra Dice:

    te amo James!!!! sos precioso actuas re lindo… me gustas mas q justin bieber… y espero q pronto llegue el cd de BIG TIME RUSH a la Argentina

  94. cinthia Dice:

    eres muy guapo el mas guapo de btr eres lindo con las chikas y quisiera conocerte pero eso no creo q sea posible bye TE AMO JAMES ERES EL MEJOR !!!!!!

  95. LUZ MARINA S.D Dice:


  96. LUZ MARINA S.D Dice:


  97. Aroa Dice:

    Ola soi jo aroa me encanta como eres eres guapo pero me gusta mas cosa de ti ami me gusta el color verde me encanta los caballos…

    Un dia me gustaria conocerte i que me diaras un autrografo de ti me encantas cantas super bien mira te doi mi email:(aroita29@hotmail.com)



  98. nelsy Dice:

    t.a.m.l.d.a.sy quieres no lo desifres da igual adios lo que se es que eres extra unico te adoro imaginatelo

  99. nelsy Dice:

    te adoro te idolatro eres todo para mi…. enserio necesitas conocerme ..james me encantas

  100. nelsy Dice:

    eres lo max .encerio todas te amamos ¡sera que no puedes dejar de ser lo max por un momento¡

  101. evelin Dice:

    te amo eres muy guapo

  102. angeles Dice:

    hellow my name is angeles quisiera verte en persona tu eres para mi hombre guapo

  103. ketzaly michel Dice:

    i love you james

  104. evyli Dice:


  105. saira Dice:


  106. sarahi Dice:

    o james estas hermoso, y aktuas super me enkantas thu y thu muxika♥

  107. carolina Dice:

    estaaaaaaaaaaaaaaaaaaaaaaaaaaaa guaaaaaaaaaaaaaaaapisimoooooo es un bombon pero si alguien sabe si van a venir avisen para saber y conocerlo en persona a y es mi novio no es chooooooooro

  108. carolina Dice:

    estaaaaaaaaaaaaaaaaaaaaaaaaaaaa guaaaaaaaaaaaaaaaapisimoooooo es un bombon pero si alguien sabe si van a venir avisen para saber y conocerlo en persona a y es mi novio no es chooooooooro y actuas de maravilla

  109. ceci Dice:

    james eres super guapo te amo estas echo de un paaaaaaaaaaaaaaaaaaaaaaapaaaaaaaaaaaaaaaaasiiiiiiiiiiiiiiiiiiiiiiito

  110. viane Dice:

    estas super gua´po y tememos cosas en comun bay

  111. maria josé Dice:

    yo soy maria me encanta james como canta y como es se ve es super divertido lo malo es q yo vivo en leon gto y me gustaria q viniera para conocernos y me encantaria q fuera mi boyfriend y si asi fuera no se perderia de nada por por a qui por mi casa hacen un buen de paris soy muy divertida

  112. lizbeth Dice:

    mmmmmmmm yo amo0 a james pr to0do0 lo0 qk es co0mo0 se viste co0mo0 abla co0mo0 es de guapo0 co0mo0 canta es muy lindo y emo0xiximo0 lo0 amo0 muzho0the
    lo0 amo0k muzho0

  113. lizbeth Dice:

    y tambien como kisiera qk binieran a mexico a dar un consierto para conoserlos en persona conoser a james qk esta vien guapo
    o qk ustedes no los k ieren conoser en persona ay qk tratar de consegirlo para qk bengan a mexico qk bengan qk bengan anda si los amo0 muzho0thee no los puedo olvidar yo se todo sobre ustedes los amo pero0 mas mas a james maslow co0mo0 kisiera verlo en persona lo amo muzho0the lo kiero0 co0noser
    lo0 amo0 muzho0 ese xavo0 si esta mo0xixiximo0

  114. maslowsita Dice:

    James te amo fulll okk

    por que tenias q ser tan guapoooooooo

  115. Evelyn Dice:

    hola para mi eres muy guapo,divertido y aveses eres algo…bueno no importa ojala me mandes un email(en español x fa

  116. andrea Dice:

    te amo james

  117. ANDY Dice:

    me encanta la serie de BTR quisiera q dieran un concierto el 15 de octubre en león.gto. desearia q me mandaras un imail a mi correo… bueno te hablare de mi me encanta el fut, el cantar, me encantan los caballos de color café,blanco,negro o a manchas no me gusta el color verde me gusta el azul espero conocerte algun dia espero q vengan a dar un concierto aqui te amo

  118. carly Dice:

    hola soy carly soy muy guapa tengo ojos verdes y meencata el verde soy
    maesra surf y balonsesto megusta el fut-bolt soy canser tengo 20 años
    es pero conoserte un dia de estos

  119. AnNaRuSh Dice:

    LOS AMO BTRson lo mejor espero q vengan a monterrey nuevo leon, todos los dias sueño q estoy en uno de sus conciertos los amo por cierto yo tamb soy cancer

    LOS AMOOOO!!!!!!!!!!!

  120. andrea Dice:

    are the most amazing guy that I would like to know depronto conosco destination we have something well prepared

  121. samantha maslow Dice:

    q bien ya se algo sobre james!!!!!!




    si alguien lee mi comentario jesenia martinez figueroa conteste plis y james eres lo maximo sigue como vas a te odio miranda cosgrove

  124. blanca Dice:

    hello mira eres lindo pero tefalta algo

  125. Ana de james Dice:

    ola nne te amo estas bien guapo hay te cuidas sueña conmigo mi james porque yo si soñare contigo mi amor te amo :) muak ♥

  126. danya Dice:

    bueno pos lo unico comun contigo es k me gusta el baloncesto
    el futboll y montar caballos es lo k me facina mas ke nada y pos lo d las mascotas el color no por ke mi color preferido es el rojo y pos nmas eso

    a i por cieto stas muyy guapo mas k nada y pos cuidate!!!
    y k tu carrera cresca mas bye t.k.m.m.

  127. @ndre@ Dice:

    mmm qe guapo james t AMO mucho t adora y tengo muchaz ganaz d konozerte t AMO muuuuuuuuak <3

  128. dianiz moreno baesa Dice:

    eres de lo mejor en big time rush y en vida real aunque me gustaria que hubira mas capitulos y que te pusieran pareja esos es todo cuidate y nunk cambies ok bye

  129. Mariela Dice:

    james are the best and no offence
    to logan,kendall and carlos you
    are the best you are the best
    of them i love you james

  130. lalita Dice:

    te amo muxhoooooooooooooo JAMES

  131. lalita Dice:

    mira elizabeth thu no eres nadien para decirnos k somos unas pendejaz d mierdas asi k kallate xk thu eres una pendeja asi k yo estoy d acuerdo con brenda ok

  132. lalita Dice:


  133. isa lapaz Dice:

    James te amooooo, soy de Uruguay y miro BIG TIME RUSH todo los dias de la semana. TTTTEEEE RRRREEEE AAAAMMMMOOOO SOS MI IDOLO

  134. isa lapaz Dice:

    James sos lo mejor de Big Time Rush y en la vida real tambies, sos mi idolo, sos lo mejor. James cuidate mucho loco y no cambies jamas xq te queremos tal y cual lo eres ahora

  135. lizbeth Dice:

    mmmmmmmmmm bueno0p denuevo0 la verdad qke me entere qke ivas a vernir amexico0 en el co0ncierto0 de justin biber la neta qke te kiero0 co0no0ser sabes yo0 te apresio mucho0 eres lindo0 veo0 siempre big time rush a un qke ya aiga visto0 los capitulo0s lo0s vuelbo0 aver en internet oigo0 diario0 sus cansio0nes y me gusta mas la de oh yea pr qke sales vien guapothe a y the dedico0 la cansio0n de tu eres para mi de isabella castillos y de andres mercado0 sabes co0mo0 kisiera estar co0n tigo0 un dia soñe co0n tigo0 y co0n kendall ,carlos y logan y obio co0n tigo0 si fuiste el primero0 en mi sueño te lo0 co0ntare a ver si se ase realidad la verdad fue qke en nikelo0deo0n sale el prinsipio de big time rush y de sia unas letras chikitasd y ay desia qke el leeyera eso0 se y va un dia co0n lo0s chico0s de big time rush y qke lo0 leeya to0do0 yo0p y qke me iva co0n ustedes y qke me besaba co0n tigo0 to0do0 el tiempo0 o0bio0 no0va a ser eso0 realidad co0mo0 te kisiera tener en frente de mi diario a y te dedico0 tu propia cansion la de worldwide esta vien linda te la dedico0 a y me boy a co0rtar el fleco0 igual qke tu y me lo0 voy a pintar igual qke tu y sabes pr qke ago eso0 eso0 lo0 ago0 pr qke te amo0 y aparte para tenerte en mi co0mo0 kisiera qke fueras mi novio0 pero0 se qke eso0 nunca va a pasar pr qke un famo0so0 no0 puede salir co0n una qke no0 es famosa co0 tu y miranda nose cuando0 me estero0 de ti y de ella me pongo0 selo0sa la enbidio0 co0mo0 en las revistas de por ti siempre las co0mpro0 para verte a ti pero0 veo0 qke sales co0n miranda y me dan muchas ganas de ronperla pero0 no0 pr ti sino0 pr miranda pero0 yo0 entiendo0 no te preocupes mmmm y co0mo0 te vistes co0mo0 cantas co0mo0 eres me agradas mas cantas vien bo0nito0 the amo0 muzho0the mi niño mo0xixixixixixixiximo0 bueno0 adios beso0s nunca lo0 0olvides qke te amo0 muzho0the
    :) :) :) :) muzhothes beso0thes para ti mi niñop mo0oxixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixixiximo0o
    bueno0 adio0s te cuidas y espero0 qke se agan re alidad mis sueños espero0
    :) :) ;) ;) :) :) ;)

  136. lucy Dice:

    james es lindo y tiene una cara hermosa

  137. jocelyn Dice:

    ho0la esta super guapo yo soe fan de el lo amo siempre veo big time rush se ve hermoso junto con sus amigos lo amo pz la vdd me gusta un chorro y kendall ,logan ,carlos tampoco van tan perdidos pero james en uniko en el mundo lo amo ,lo amo ,lo amo,lo amo

    by: jocelyn arizbel no soy una loka maniatika eeee… lo digo pork asi ae muchas y pz no nos llevamos tantos años de diferencia
    bae hermoso

  138. jocelyn Dice:

    eres super guapo hermoso desde k te vi y supe k existias me enamore de ti oviamente tu iluminas la pantalla toditita te amo spero k me conteste alguien tu onose no estoy loka pero la vddd eres el 1er cantante k me facina y k al verlo me ilusione y me enamore de ti… spero k tu y tus amogos tengan buen exito para toda la vida… les deseo lo mejor a todos suerte y ojala sigan firmando peliculas program,a y videos mucha suerte

    by:una loka k muere x conocerte solo k no hablo ingles o españo9l la vdd nada de eso muy apena s saco 9o10 en los examenes pero en fin puff de vddd buena suerte muchahchos cuidense de las loka maniaticas jajajajaj lo amdora y james lo amo spero k ustedes leean mis comentarios los kiero bae

  139. kamila rivero Dice:

    james eres muii lindo daria todo podo por conocer a un chico como tu te amo muxo

  140. domin Dice:

    enrealitad james esta muy guapo pero no me agrada mucho en la serie creo q me gusta mas logan lo digo sin ofender creo q muchas lo asen por pareserse a usted o a ti como lo quieras tomar.

  141. sharon Dice:

    james you are extremely beautiful your eyes are stunning your smile makes me sigh your lips are fantastic and your whole body is amazing I hope to meet the target must have something good in store for we

  142. brithney Dice:

    aprendan VIEJAS LOCAS JAMES MASLOW ES EL MAS guapo de la banda!!!!!!!!!!
    y yo lo reclamo

  143. karla Dice:

    eres genial james eres l mas guapo d los 4 d big time rush.
    eres mejor q logan

  144. jane taylor Dice:

    OMG es komo mi gemelo a mi me gustan todas esas cosas!!!!!!!!

  145. cielo joselyn Dice:

    james te amo mucho soy tu admiradora num 1 te amo como quisiera conoserte tambien como quisiera que big tan rush diera su concierto en villahermosa tabasco y yo veo big tan rush y como quisiera tambien que james sea mi novio y mi numero de casa es 140 41 30 llamame cuando quieras esrare tu llamada

  146. johanna fenske Dice:

    q guapo es james yo sueño casarme con el pero no se va a fijar en mi soy de otro pais que lastima encima vieron lo hermoso q es te adoro james maslow

  147. chepi Dice:

    James tas q te partis sos divinoooooo te adoro con el alma y me encanta el surf y andar a caballo igual q a vos!!!!1 t adoro!!!!

  148. ShIrLeY sAnChEz Dice:

    James eres tan lindote………….tu cabello es genial-tus cejas son perfectas-tu nariz es muy linda-tus labios…mmm…-tu cuello , no se porque pero me gusta mas aun por el lunar que tienes en el lado derecho de tu cuello y yo tengo un lunar en el mismo lugar que el tuyo-y tu cuerpazzzo wuau enserio que un cuerpazazo..con esos musculos quien te ganaria….SIN DUDA ERES EL CHICO MAS GUAPO DEL MUNDO—I LOVE YOU

  149. amo a james Dice:

    amo a james auque tenga novia :(

  150. lourdes Dice:

    bueno a mi james me parece el mas lindo,hermosa,precioso de la serie big time rush me encanta como actua es re simpatico y re fachero me encanta cuando sonrie y se peina en la serie bueno chau TE AMOOO JAMES…

  151. eli Dice:

    es hermoso TE AMO james

  152. lourdes Dice:

    james eres muii lindo daria todo por conocer a un chico como tu te amo mucho:D :) :)

  153. caro enrqueta Dice:

    llo soy una de las mayores fans de james es demasiado buapo


    JAMES TIENES QUE SABER QUE SOS EL AMOR DE MI VIDAA JAMAS VI AL AMOR COMO LO VEO CON VOS ,SOS ESPECIAL ,PERFECTO,HERMOSO,TIERNO,DIVERTIDOO ,ROMANTICOO,HERMOSO,ja!…Y MILLONES DE COSAS MAS QUE NO SOLO LAS PALABRAS LA PUEDEN DESCRIBIR …..YO SIENTO QUE CADA DIA QUE PASA MAS ME ENAMORO LA PRIEMRA VEZ QUE TE VII EN I CARLYY MEENAMORE Y DESDE AHII COMENCE A BUSCARTE EN INTRENET TUS FOTOS TOODO! CUANDO LLEGASTE A BIG TIME RUSH DIJE:no puede ser el chiko que me gusta tiene su propia serie ahhhh grite tantoo! :O y me emocione fue una esperiencia unica y desde entonces nunca me despego de la tele!seria un sueño poder estar con vos y conocertee entregarte todo mi amor !♥♥♥♥serria un sueño que yo gane la entrada para los kids choice awards argentina 2011!(donde van a estar presente ,,,te describo mu habitacion”: paredes de color verde(a mi tambien me encanta el color verde como james!)ahh les sigo contandoo:las paredes de mi cama son 3 las tres llenas de postres de big time rush y de jame s! los amo en especial JAMES! SOY LA FAN # 1 DE BIG TIME RUSH y lo voy a seguir siendoo por siempreee!♥♥♥no hay comparacion lo que siento por jame ses unikooooo me encantaria conocerlo personalmenteee!!! seriaaa woooooooooow lo mas asombrosooo de mi vidaaa ….
    CADA VEZ QUE PASAN POR NICKELODEON BIG TIME RUSH ME ENLOKESCOO Y BAILA CANTOO TODOO ,,,,,ES LAMEJOR SERIE Y POR SER COMO SON LOS AMOOOO!SOY LA RUSHER’ MAS GRANDE QUE HAYY NO TENGO COMPARACION tengo todo de ellos se cuanto calzan miden que comen todooo se todas las canciones que por siertoo son las mejorees!!!sus videos y vii y tengo toditas sus fotooos! que son las mejores de todo el mundoooo!
    viiviria toda mi vida a full con james ojala se cumpla mi seuño y el de toda fan
    ahh y esoo que puso ELIZABETH estademas porque ni siquiera conoce a james y diec y noc dice pendejas ni siequier sabe cuantos años tengoo ni tampoko se lo voy a decir porque no le incunveee no sos nadie ni me intresaa ,,,,estoy de acuerdo conla chika que dijo debajo de tu caomentariooo …..yo tambien amo ajames y se qye toda fan dice:james es mio ,james es mio,,,pero sabemos que las personas no tienen dueño yo lo amoo llo voy a seguir amando y defiendoo alas fans que vos trataste masl te quedoo clariito!?¿perdon si lasmoleste chikas yo en realidad lucho por lo que qiero y defiendo lo o no mioo buenooo esto que digoo parece un diccionarioo …
    james sale prefectoo en todos los videos fotos comerciales lo que sea! por que es un chiko perfecto incomparable que no tiene reemplazoo en mi vidaaa lo amooooo les cuento que hace 2 años esudio teatroo y por segunda vez fui protagonista de dos obrass baiilo hace 5 años viaje a varias provincias de mi pais y quiero llegar ala cima con mi sueñoo!!que me enacantariia ,,,,,,,,no hablo de estoo con nadieee ,,,,,,pero confio en cada fann.-.-…-..–soy lider de un club que se lama las rusher’s en facebook si quieren unirse envienme la solicitus mi facebook es:ludmila fernandez (james) y entonces nos unimos todas yo soy de argentinaaa!y este añoo dentro de 6 dias vamos a bailar en la escuela bailamos riock and roll con mis mejores amigas………….JAMES TE RE AMOOO SOS MI DROGA VITAL LA QUE CADA DIA ME CUIDA …..LAS ESTELLA MAS HERMOSA DEL UNIVERSOOO MI STAR FOREVER :D ahh y tambien cantamos y yo toco la guitarra me encanta el arteee!!!y los caballos me encantann!! miro big time rush a diario compro todos los meses las revistas en las que salen sus fotos!por mas chikita que sea la comprooo

  155. Carla Dice:

    Aparta de super guapo es deportista y con una biografia estupenda I LOVE JAMES DAVID MASLOW

  156. Carla Dice:

    :) (KISS#)

  157. cielo joselyn Dice:

    amo a james veo big time rush sienpre aunque vuelva a ver los capitulos oigo sus canciones diario me gustan todas las canciones pero me gusta mas la de oh yea por que sales muy guapo y pues ojala se as mi novio pero ya se que nunca se realizaran porque un chico famoso como tu no puede ser novio de alguin que no es famosa como yo bueno pero como quisiera que se aga re alidad mi sueño y siempre sueño con tigo y sueño que tu y yo somos novios y en mi cuarto te tengo en una foto de internet pegada en la pared y pus mre gusta como cantas bueno adios te dejo mi numero por si me quieres ablar se que no me ablaras por que no me conoces pero ojala me ables es 140 41 30

  158. estefania herrera Dice:

    wooooooooooooooww geeniiall

  159. nayeli Dice:

    te amo james eres el mejor y eres mio solo mio estas como quieres bomboon

  160. marianela Dice:

    james te amoooooooooooooooooo

  161. marianela Dice:

    james te amooooooooooooooooooooooooooo

  162. nayeli guadalupe Dice:

    james eres muy guapo eres el hombre mas guapo del mundo y eres mio estas como quieres y te amo

  163. perla Dice:

    ho0la jmes te amo0 co0n to0da mi alma yo0 se que exajero0 mucho0 pero0 es laaa verdad nunca em mi co0rta vida habia sentido0 esta o0bsecio0n po0r alguien no0 tengo0 ni no0vio0 po0r que yo0 dijo0 que tu eres mi no0vio0 yo0 se que o0tras pueden decir lo0 mismo0 mi gran sueño0 es que venga BIG TIME RUSH A TIJUANA BAJA CALIFORNIA migran gran sueño0 es co0no0certe bueno0 a to0do0s pero0 mas a ti te amo0 y que casualidad yo0 tambien so0y cancer y cumplo0 año0s en julio0 el 22 y tu el 16 el dia en que cumplistes año0s me desperte y dijeen do0nde quiera que estes feliz cupleaño0s que te la pases super bien y abraze a una ahlmo0ada que e llama james yo0 y mi hermana tenemo0s almo0adas co0n lo0s no0mbres de ustyedes james carlo0s lo0gan y kendall james y carlo0s so0n mio0s y lo0gan y kendall de mi hermana no0 me pierdo0 ninguno0 de sus capitulo0s aunque sean repetido0as no0 me impo0rta

  164. saariitaa Dice:

    aaay si niñas james es lo mas lindo de nickelodeon

  165. Viicky garciia de maslow Dice:

    Oola jam3z pz la neta eres muy guapoo te amooo erez el mejor de btr cantas genial amoo todas zuz cansionez las eschuchoo diarioo y tu elizabeht mira asnos un grandicimoo favor CALLATEE!!! qierez james jamas va a ser tuyoo asi qe deja de soñar y no tienes xqee decirnos pendejas la pendeja erez tuuuu¡¡¡ Y me vale verga lo qe piencess siii byee y jamez te amooooooooooo erez el mejor chavoo in the world welcome tho my lefee y lovee youu!!!

  166. Courtnei Dice:

    hello me gui of the theret world amm james maslow of the mee luctions of mee c
    countri emm James and mee are of time omm as is ok james is me me me Ok is k no never james of ba a ilove ok ocnor pplis the and me fois Boifriends Ok Fuck for tois fuch Girls Ok

  167. Denisse Dice:

    Hello girls I want to say that james is mine mine mine Maslow so do not say shit k k bitches are not shit ok i ment james aka tubimos a relationship in the United States so that k nothing will ever separate us from you ok ok bitches

  168. Linette Dice:

    hola james eres el mas lindo y guapo de los big time rush te amoo

  169. vislabia Dice:

    te aaaaaaaaaaaaaaaaaaaammmmmmmmmmmmmmmmmmooooooooooooooooooooooooooooooo james mi numeroes971808034 llamame mi amor

  170. Linette maslow Dice:

    Hola james te amo eres el mas guapo de big time rush quisiera conoserte soy Linette de maslow Jaja ok no eres un chico guapo

  171. mierda maslow Dice:

    bueno pendejitas no pueden ser mas estupidas xfavor no se dan cuenta que james no les va a dar bola nunk ni lo conocen y ya lo aman pendejas inmaduras que taradas como se nota qe no tienen vida propia y se tienen qe estar enamorando de personajes de series me dan pena

  172. mierda maslow Dice:

    la verdad son cualqier cosa xq no les va a dar bola el chavon no piensan q jamas va a estar al su alcanse no piensan miren puteen agan lo q quieran pero se la mandan esta es la verdad…..y la verdad ofende no pueden ser tan tontas se pelean y encima mienten claro ahora a todas les gusta lo mismo q a el cualquiera me dan risa encima re alsadas y regaladas como se nota q son unas nenas q no saben lo q dicen ni el ni ninguno, de la tele les va a dar bola taradas den se cuenta!!!!!!!!!!!!!!!!!! encima mas estupidas impocible no se da cuenta q pelean por interner con alguien q i conocen jejejejej me mato de la risa con ustedes trolas pendejas digamos la verdad sos re chotas chicas no piensan tienen la cabeza re matada de mierda CHAU PUTITAS LOKAAS

  173. Linette Dice:

    Mira mierda maslow o como te llames tu no eres nadie para desirnos pendejas primero aprende a respetarte a ti misma y luego dises lo ke kieras pero no cabe duda que así es la gente naca y sin educación y nos vale lo ke digas seguiremos amando a james lacra k eres

  174. vislabia Dice:

    bien dicho amia las nacas solo ablan asi porke no tienen educasion y no saben respetar alas personas como ella es un animal ke salio de un callejon ke no tiene modales esa tal maslow sera machona por eso tiene selos de nosotros pork a nosotros nosgutan los MACHOS y kiere ke nofigemos en esa machoRRa

  175. vislabia Dice:

    las malditas arrastradas ablan asi nada mas ke lla estan guecudas por los dos lados

  176. elisabeth Dice:

    you are very nice james the most beautiful of the world i love you

  177. elisabeth Dice:


  178. hazael Dice:

    hola james guau eres una super estrella del pop me gusta como actuas en el programa de big time rush es pero que me contestes algun dia porfis soy tu mejor idolo y megusta como cantas y espero conocer a todo el elenco de big time rush y en especial ati y espero que llege tu disco a mexico y en especial ami y ami primo

  179. Linette Dice:

    Claro Vislabia gracias x apoyarme Pz es la verdad hay Ke tenerse respeto a Sii mismo

  180. Linette Dice:

    Tienes razón Vislabia todo lo ke comentaste es la pura verdad gracias x apoyarme es una arrastrada ke nos tiene celos x ke nos gusta el bombón de james maslow Jaja pobre roña

  181. andrea Dice:

    dios ese chamo me tiene loka te amoooo <3

  182. mierda maslow Dice:

    jejeje chicas me dan verguenza no les tengo celos xq tenerles celos si el chico no les va a pasar ni la hora ni ami ni a ustedes estupidas y si tengo educacion no como ustedes taradaaas!!!

  183. amo a james y a todos de big time rush Dice:

    james es mi marido lo amo ja

  184. T.K.M JAMES Dice:


  185. T.K.M JAMES Dice:


  186. vislabia Dice:

    lla me estas llegando al pinch0o maslow y a ti ke chucha te inporta si no no va aser caso estas en nuestra vida preokupati porti y no por nosotros y a ti ke te inporta si no noskeremos es nuestra vida no mte metas y listo deja de ablar guebadsa y bete ala mis esatabien no te metas en lo ke ablemos maldita

  187. alejandra Dice:

    hola te amo james te adoro quiero conoserte yo te adoro

    casate con migo te amoooooooooooooooooooooooooooooo

  188. stefany gomez peña Dice:

    te a mo0 james eres unico

  189. natalia grijalba Dice:

    james eres lindisimooooo ♥♥♥♥♥♥

  190. paula Dice:

    isidro y paula aman mucho a james maslow pero lo ama mas paulaI(te amo mucho james maslow)

  191. megan Dice:

    i love you james and you friends is awesone

  192. mierda maslow Dice:

    chicas miren tenemos la vastante educacion q necesitamos no como ustedes q no valenn un dopeeeeeeeeeeee si espero q les qede bien en claro q sos todas unas biluditas solo nenitas chicas q aman a alguien q ni conocen se asen la cabeza sola xfavor en q mundo vien en q planeta aterrisen de una vez y desen cuenta nos vemos porque no vale la pena seeguir puteando a tantas mierda conmo ustedes jejejej de dan risa me dan verguenza TARADASSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS y encima el ni las registra ni se mete ala pajina…… chotas

  193. petra sttG' Dice:

    aww…amoo a Jamess mee encaantaa estaaa supeer guuapiisiimoooooo!

  194. pamela Dice:

    es muy interesante su biografia, estan lindo lo amo

  195. pamela Dice:

    te amo muxo muxo james maslow

  196. marianela Dice:

    te amo muchisimo james

  197. paula Dice:


  198. paula Dice:


  199. marianela Dice:

    james te amoooooooooooooooooooooo y ninguna de estas te quiere solamente yo muaaaaa

  200. lalo Dice:

    hola james te admiro mucho y aunque tengo 9 años te digo que busques novia y dile a logan y a carlo QUE DEJEN DE BUSCAR AMIGOS Y QUE BUSQUEN NOVIA

  201. fernanda Dice:

    james eres lo mejor las canciones son geniales encerio es la mejor banda dl mundo ojala y pudiera conocerte pero como no es asi pues por medio de esta publicacion o comentario te quiero desir que BTR es fantastico y estoy segurisima que soy su mayor fan la #1 me di cuenta que ganaron las navesitas de nickelodion de echo yo bote por ustedes lo amo encerio en especial a ti como quisiera una foto con ustedes y un autografo tuyo pero bueno espero tenerlo algun dia vuelva pronto a mexico estaremos esperando un nuevo concierto te amo

  202. lismery Dice:

    te odio

  203. lesly Isabela Montes Hobinston Dice:

    es grandioso me encanta y kisiera conocerlo en persona ,seria un sueño hecho realidad

  204. caro Dice:

    estas super guapo y ojala vengan a san luis potosi y no cobren muy caro jajaja para verte x q tu eres el mas guapo de btr sin duda ojala un dia te pueda conocer i love

  205. Sabri Dice:

    Hola amo a James Maslow es el mas lindo de Big Time Rush la verdad es que cuando comense a ver la serie me parecio lindo Logan luego Kendall y ahora James para mi esel chico mas hermoso del mundo lo amo con todo mi corazon y juro en frente de todas mis amigas que algun dia lo voy a conocer no me interesa si tengo 10 15 20 o 25 años no me importa yo lo voy a conocer personalmente. James si algun dia llegas a ver esto te digo encerio que te amo no soy de esas chicas tontas que se la pasan locas hasta si te ven en la tele se ponen a gritar como locas y eso tal ves te deve asustar pero te digo que yo no soy de esa clase de chica la verdad es que te admiro mucho me encanta tu vos tu caracter tu forma de ser tu forma de tratar a las chicas y te juro la chica que ha sido tu novia tu mucha pero mucha suerte la verdad es que cuando tube un dia duro me pongo a escuchar las canciones de la banda y me tranquilizo totalmente gracis x todo te quiero demasiado y espero algun dia conocerte. Yo soy de Argentina Neuquen y si algun dia llegan a venir a la Argentina yo voy a ser la primera persona que compre la entrada y voy a estar en primera fila te amo ojala algun dia podramos conocernos TE AMO!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  206. dami Dice:

    james te amo sos el mejor del mundo sos unico unico cuando apenas te vi me enamore te amo desd eel primer dia cad ave ske te veo cantar y bailar siento ke me enamoro mas y si te pasa algo malo me mato de verdad me corto las vena me claov un cuchiyo no importa si te pasa algo malo me voy a matar de verdad no me va a importar me voy a matar sea como sea xq te amo sos unico nunc ame enamore asi de verdad sos unico JAMES SIT E PASA ALGO MALO ME MATO DE VERDAD NO ME IMPORT AKE ME PASE ME MATO XQ SOS UNICO

  207. dami Dice:


  208. mierda maslow Dice:

    lokassssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss la pajina esta para no desilucionar a la fans el janas a visto esta pajina pavas desgarradas forradas y culiadas

  209. Pamela Campos Arizmendi :) Dice:

    Jamess! te amoo !! :D Me encantaria conocerteee! Estas Muy Guapo y hermosoo Parases la Octava maravilla y eres El mejor De La banda Big time rush<3 Cuando te vi por primera ves en La serie de nickelodeon me enamoree! fue amor a primera vistaa! ;3 Me encantaria conocertee ! Jamess te amooo!!

  210. james maslow Dice:

    thanks everybody I’m very busy with the show and the guys of BTR but I want you to know that I read all the messages posted here, and some (most) I read with translator

  211. grecia@MaSlOw Dice:


  212. caro Dice:


  213. james maslow Dice:

    thanks everybody our fans are the best WE LOVE OUR FANS

  214. america Dice:


  215. tiffany Dice:

    te amooooo jamesss

  216. maria guadalupe Dice:

    te amooooooo ers el mejor james igual que todos los solistas de big time rush
    ers el mejor cantante del mundo te amoooo y me gustaria conocerte

  217. Nathy Dice:

    Hola James tengo 9 años te amo muchisimo quisiera conocerte en persona por favor vengan a Ecuador,Ibarra Bye James recuerda te amo y siempre lo are

  218. Nathy Dice:

    James tenemos cosas en comun yo tambien soy signo Cancer y el verde es uno de mis 3 colores favoritos eres guapisimo si te conosiera seria un sueño hecho realidad TE AMO JAMES

  219. monserrat Dice:

    ola james te amo eres lomejor te quiero conoser a igual a big time rush ese seria mi mejor sueño de la vida te mando muchos kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss kiss quiero conoser tanbien a logan recuerden que los amo vengan a santiago de queretaro o a esta escuela es santiago de queretaro se llama independencia y libertad colonia loma bonita ilove ilove ilove ilove

  220. keila rodriguez Dice:

    james soy keila tengo 16 años y me encantaria ser tu novia si me quere veni a honduras soy modelo de bikinis te amooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

  221. james maslow Dice:

    hahaha thanks but I can’t travel still ’cause I’m so busy, that I haven’t time for connect here.

  222. marisol Dice:

    james eres super guapo eres lo mejor y todas las que dicen que james es “gay” y todo eso es poque son unas taradas de primera en especial “mierda maslow” es una lucer y ademas si no te gusta james porque estas biendo su biografia.
    ademas todas las que entran a esta pagina es porque quieren conocer mas a james, lo aman y tienen educacion no como “mierda maslow”

  223. sami Dice:

    lo adoro aun q !!!!…!!!NO ES micantante favorito::: es justin bieber

  224. sami Dice:


  225. mimi Dice:

    a ver todas las chicas que an escrito no se peléen por elxq el nilas conoce ni sabe quienes son ustedes y yo zomos desconocidas para james maslow asi q mejor ni digan pendejadass que nadie se loz vá quitar y quien sabe que tantas cosasponen y no lo voy a negar que quisiera conocer a james pero se que nunca va a pasar bueno si lées esto james eres muy simpatico y eres super baaay tqm

  226. james maslow Dice:

    hey, what’s up? hehe, i’m passin now, because that I here with kendall, logan and carlos watchin’ videos in youtube.

  227. lupita Dice:


  228. pati Dice:

    0la james kier0 decirte lo guapo y lo genial q eres, y0 también soy cáncer y no estoy mintiendo, lo único en común en los deportes es q a mi también me gusta el fútbol, yo también tengo un perrito llamado scuby se q esta un poco cursi pero fue el único nombre q se me ocurrió TE KIERO 1000 CUÍDATE q tela pases super a y me saludas a todos de big time rush ADIÓS

  229. Nathy Dice:

    Eres guapisimo James I LOVE

  230. genesis Dice:

    james eres hermoso te amo

  231. DELFI Dice:

    james maslow sos super lindo re buen cantante y sos el mas lindo de todo el mundo

  232. DELFI Dice:

    james sos super lindo y te re amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

  233. santiago Dice:

    james tenes un perro fantastico ysos el mejor cantante de big time rush

  234. jael Dice:

    james eres muy lindo mas lindo que
    justin bieber y nick jkonas

  235. camila Dice:

    eres ermoso
    pero mmmmmmmmmmmmmmmmmmmmmuuuuuuuuuuuuuuuuuyyyyyyyyyyyyyy lindooooooooooooooooooooooooooooooooooooooooooo

  236. julieta Dice:

    tu serie aunque tengme eeeencaenta a 6 años en fin espero ce llegen los cds de big time rush

  237. MarRii Dice:

    they have to know that i am the biggest fan big time rush!!!!!!!!!!!!!!!!!!!!! but especially james masliw………………….because i love it and love it i love all of the,,,,,,,,,,,,,,,,,,everything, everithing, so do not mess with the stupid ok

  238. alice maslow Dice:

    hey james you are so hot, and I LOVE YOU

  239. james maslow Dice:


  240. meli Dice:


  241. paulina Dice:

    hola james yo te visto en persona en el concierto de justin bieber estavas guapisimo cuando cantabas tan bien quisiera ser tu amiga todo el año 1000 quisiera que vivieras en mexico para que te vea todos los dias en un ci cierto con

  242. brenda Dice:

    te amoooooooooo te amoo desde el primer momento en que te vi

  243. luisa fernanda zapata zapata Dice:

    eres un papasito wuapo y espero q benjas algun dia a colombia

  244. tefhy Dice:

    mira elizabeth no es que me creo la gran cosa es mas pocible que james le aga caso a todas nosotras que a vos prostituta pizada asi que te me calmas mamita te la queres tirar de bufoncita y ni el primer pijazo me lo aguantas ok lerda anda pizate un burro lo qu queras ecepto a james pero a mi ninguna estupida me va a decir pendeja ok cara de mi ……….?????

    i love james a i a todas las chicas no se dejen de esa tal elizabeth

  245. tefhy Dice:


  246. alondra Dice:

    te amo JAMES espero algun dia poderte conocer xq te amoo eres super guapo y deseo k alguna vez vengan a mexico a dar un concierto

  247. samantha Dice:

    t adoro james maslow estas muy ggggggguuuuuuuuuuaaaaaaaaaappppppppppppppppoooooooooooooooo y amo big time rush BTR

  248. james maslow Dice:

    Hey guys! as they have been?
    Thanks to all for the support to the band!
    I have to say no need to fight for me, lol
    I love them with all my heart

  249. delfina Dice:

    yo no lo amo pero me gusta como actua y canta no lo amo por que yo se que el no es real aparte ami me gusta kendall pero chicas no se obsecionen con esos chicos porque seguro que ellos no saben nisiquiera que existimos
    aah y anna PONELE!!!! que se ba a casar con vos el nisiquiera sabes que existis aparte el habla ingles el unico que habla un poco el español es carlos por que nacio en un pais donde se hablaba el español y de ahi aprendio pero despues se mudo a florida y aprendio el ingles y todavia se sabe el español !
    yo lo vi a carlos cuando me fui de bacaciones en donde nacio y lo vi pero como no era famoso yo no le di bola

  250. delfina Dice:


  251. andrea Dice:

    olaaaaa yo amoo a james maslow pero no soy una fanatica loca pero tambn mi colores favorites es el azul cielo y el verde encerio mis 15 años era del color verde claro y azul fuerte lo amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo amooooooo :D

  252. andrea Dice:


  253. maria joseceron Dice:

    te adoro soy muy fans ven acolombia acali y megusta tuschocolatinas ( tus musculos y te amo qui ero ser tu novia

  254. anamaria ruiz Dice:

    eres muy lindo y tambien me gustan tus chocolatinas(tus musculos)

  255. blanca Dice:

    jamez te amooooo pero mi corzon de pertenese a carlos peña espero que vengan a colima

    con cariños zuci walmer

  256. blanca Dice:

    con cariños su mejor sueño en la vida

  257. blanca Dice:

    y su mejor amiradora en mi vida y en la sulla

  258. andrea Dice:

    ashh blanca q dices james esta guapiiiiisiiinooooo eee carlos peña eeeuuu bueno very godd jejje pero carlos q asco

  259. andrea Dice:

    oigan a los fans de¿¿¿ logaan¡¡¡¡ henderson sufrio no se q dia pero sufrio una baja de azucar se desmayo y lo llevaon a una clinica pero aguarden jejeje estabn ya salio de la clinica :)

  260. alison Dice:

    queee encerioo wowwjejej es feo na no es cierto q lastima aaaa todas formaslo amo

  261. rocio Dice:

    a mi amiga le gustas ami ni en pepe para ami sos feooo!!

  262. marielys Dice:

    te amo demasiado pero no tanto como logan henderson lo unico malo que hay en el es que es muy flaquito parese un espaguetis y no tiene pompis como carlos pero haci lo amo y siempre lo amare besos . muuuuuuuuaaaaaaaaa t.k.m

  263. alison Dice:

    ok pero no te pone triste q le pazo a logan eee??’ marielys?” t alegraa???

  264. nina Dice:

    eres super lindo james

  265. adriana Dice:

    te amo y mee gustas y yo no soy tan ridiculas como las otras

  266. adriana Dice:

    te super amo bay mi gran esposo

  267. alison Dice:


  268. arely i love james Dice:

    tkm james te amo eres genial y el mas guapo bueno siempre estamos peleando mi hermana y yo y dice kendall es el mas guapo y yo le digo no es sierto es james y si eres tu el mas guapo de todos te amo i love bebe te espero aka en tampico haber cuando bienen xq son muy guapos bay te amo soy tu fan number 1

  269. alison Dice:

    calla yo soy

  270. alison Dice:

    te amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo te casas conmigooooooooooooooooooooooooooooo porfas te amoooooooooooo l love you

  271. MARIA BELEN Dice:

    Hello que tal. Estas guapo soi fAn tuyo y ahora estoy viendo vuestro episodio te amo bayyyyyyyyyyyy T.Quiero..M

  272. alison Dice:

    maria belen yo lo vi = es sobre que big time rush obio sobre todo james van a la escuela jejee ese episodio bueno todos los episodios me encantan i love you james D.maslow so much

  273. bela Dice:

    te adoro sosssssssss lo peor un beso te odio con amor bela

  274. zendaya Dice:

    5ete odio mucho sos lo peor del mundo te odio ok chau bobo james

  275. aylen Dice:

    te amoooooooooooooooo

  276. zendaya Dice:

    te odioooooooooooooooooooooooooooooooooooooooooooooo

  277. kiara yarely Dice:

    te quiero james chiquito papasito me muero por conocerte

  278. alison Dice:

    te odio zendeya sos no saves nada james es ermoso

  279. paola Dice:


  280. melisa Dice:

    sos el mas lindo de toda la banda te re amo me muero por verte hermoso

  281. blanca Dice:

    pues yo no no lo creo es feo

  282. mario Dice:

    eres un buen cantante
    y una buena voz

  283. mario Dice:

    tengo un trato

  284. mario Dice:

    muchos fans
    intenta superar el records de mas fans

  285. alison Dice:

    obio mario yooo loo amooo jame
    amooooooooooooooorrr bonbonnnn ¡¡¡¡¡

  286. james maslow Dice:

    hey what’s up?
    thanks all we fans
    BTR love her and his fans, they’re so awesome

  287. Eric Uriel Perales Lopez Dice:

    espero conocerte en persona eres el mejor soy tu fan numero 1

  288. andrea Dice:

    aaaaa mi amor mi cumple fue el
    13 amor te ammomo aaaaa aaaaaaaaa bonbonn

  289. andrea Dice:

    hola james solo quiero decirte q eres muy guapo y actúas muy bien en big time rush cantas muy bien espero q buelban a México con un concierto un consierto 100porciento big time rush T.K. M




  290. julis Dice:

    te amo james david mazlow eres el mejor,eres guapo,te kiero me encanta como cantas yo creo que eres el mejor de big time rush, te kiero, te kiero, ya tienes 21 años y aun eres guapisisisisisisisimo

  291. mario Dice:

    donde sera tu proximo concierto
    eres el mejor
    y si alguien no lo cree no te a oido cantar

  292. blanca Dice:

    eres invecil es mas todas sois inveciles james maslow es un g

  293. mario Dice:

    qe as dicho blanca james es el mejor cantante
    as visto todo lo qe an puesto sobre james y la mayoria es positiva
    y creo qe tu eres la invecil verdad chicos y chicas

  294. blanca Dice:

    quien te va a creer e niñato no sabes na
    y yo no soy la invecil sois vosotros

  295. mario Dice:

    pues qe voten todos los qe esten a favor de qe james es el mejor qe digan si
    los qe no esten a favor de qe james es el mejor qe digan no y tu eres la niñata blanca

  296. blanca Dice:

    si tu sigue diciendo todo eso pero van a votar qe es un invecil

  297. mario Dice:

    very good pero ya veras blanca la mayoria dira qe es el mejor
    y ya te vas callando niña

  298. blanca Dice:

    inveciles y lo digo para los qe an dicho qe es guapo
    sobre todo a ti mario

  299. mario Dice:

    qe,eres eres vamos pero vamos

  300. mario Dice:

    no me atrevo a decirlo

  301. mario Dice:

    sisisisiis claro james no es invecil verdad james

  302. blanca Dice:

    callate niñato
    eres un gili

  303. blanca Dice:

    y vamos

  304. barbie Dice:

    mario tiene razonjames es el mejor

  305. blanca Dice:

    callate gili de barbie tu y ese mario sois estupidos

  306. barbie Dice:

    si nosotros somos estupidos tu eres mas

  307. mario Dice:

    eeeee no te pases a un niño vale pero a una niña

  308. mario Dice:

    barbie tiene razon y tu eres una

  309. barbie Dice:

    que dices ahora heeeeee somos 2 contra 1

  310. blanca Dice:

    porqe no os dais un beso en los lavios mua mua

  311. blanca Dice:

    no amiga estupida sois dos contra dos

  312. barbie Dice:

    y por que no te lo das tu a ti misma egocentrica

  313. ismael Dice:

    blanca tiene razon es estupido

  314. barbie Dice:


  315. barbie Dice:

    tu eres el estupido

  316. ana Dice:

    ismael y blanca tienen razon sois estupidos

  317. blanca Dice:

    mario eres un gilipollas
    y tienes novia qe es esta barbie

  318. barbie Dice:

    y otra mas que james malow canta muy bien y si no hos gusta no hos metais en su pagina para discutir

  319. mario Dice:

    si tu eres la gilipollas y ni se te ocurra contestar

  320. barbie Dice:

    mira quien fue ha hablar la blanquita y su noviecito ismael

  321. andrea Dice:

    mario y barbie tienen razon sois estupidas

  322. barbie Dice:

    bien alguien que se une a nuestro vando

  323. barbie Dice:

    (y estupido esta ismael aunque no se yo si es del todo hombre)

  324. mario Dice:

    y por qe no lo aces tu

  325. barbie Dice:

    ahora hos habeis quedado mudos

  326. blanca Dice:


  327. barbie Dice:


  328. james maslow Dice:

    gracias barbie y mario

  329. barbie Dice:

    asi que ademas de listilla eres tonta
    barbie es un nombre de mujer

  330. barbie Dice:

    por que

  331. james maslow Dice:

    sois los mejores

  332. barbie Dice:

    eres james de verdad

  333. barbie Dice:


  334. james maslow Dice:

    muchas gracias quiero conoceros

  335. barbie Dice:

    james tienes hotmail

  336. james maslow Dice:

    me dejais os cantare alguna cancion

  337. barbie Dice:

    dinos lo

  338. barbie Dice:

    claro que si

  339. mario Dice:

    de veras siisisis

  340. james maslow Dice:

    claro no me aveis oido

  341. barbie Dice:

    canta canta

  342. barbie Dice:


  343. barbie Dice:

    tienes hotmail

  344. james maslow Dice:

    blanca si fueras mayor y yo no tuviera novia qeria qe fueras tu

  345. james maslow Dice:

    mi novia

  346. barbie Dice:

    jajajjaaja deveraas
    nada me haria mas feliz y quien es la super afortunada

  347. james maslow Dice:

    pero eres mayor

  348. barbie Dice:

    quien es tu novia

  349. barbie Dice:

    mmm… es que esto es una red social que mucha gente lo puede ver dame tu correo y si quieres por hay te lo digo

  350. james maslow Dice:


  351. barbie Dice:


  352. barbie Dice:


  353. james maslow Dice:

    menos mal qe tu amigo me dijo tu nombre

  354. barbie Dice:

    jajajajaja es que nos conocemos en persona pero me gustaria que tu tambien te conociera en persona

  355. james maslow Dice:

    bueno que me dices

  356. barbie Dice:

    de que

  357. james maslow Dice:

    si bueno lo que digan mis fans

  358. barbie Dice:

    james me encantaria seguir hablando contigo pero me tengo que ir a comer luego a las y cuarto estaras aqui

  359. barbie Dice:

    luego me lo dices porfis que me tengo que ri

  360. james maslow Dice:

    qe me dices

  361. barbie Dice:

    que si estaras luego por fa

  362. james maslow Dice:


  363. james maslow Dice:

    me voy

  364. barbie Dice:

    james ya estoy

  365. barbie Dice:

    y tu

  366. barbie Dice:

    aun sigo aqui

  367. barbie Dice:


  368. barbie Dice:

    ¿si te conectas aunque no lo creo?

  369. barbie Dice:

    sigo aqui

  370. santiago Dice:

    james mi hermana ve big time rush y el 28 de noviemre fue su cumple i oyo

    que el que conteste más preguntas gana un cd puedes mandarle un mensaje de felicidades porfa mandale eso

  371. blanca Dice:

    sigo diciendo qe barbie y mario son estupidos

  372. blanca Dice:

    eres eres

  373. mario Dice:

    si pues tu eres mucho mas y no contestes

  374. mario Dice:

    barbie conectate
    y tu no blanca estupida

  375. mario Dice:


  376. andrea Dice:

    mario y blanca tienen razon y tu no blanca

  377. blanca Dice:

    qe anda qe tu niña desalmada
    fuera de aqui

  378. mario Dice:

    ja somos dos contra uno
    bien echo andrea

  379. blanca Dice:

    bla bla bla bla no se as ingenuo todavia no emos acabado

  380. mario Dice:

    nadie me llama ingenuo ingenua

  381. andrea Dice:

    estas celosa de que seamos dos contra uno

  382. blanca Dice:

    yo no estoy celosa de vostros dos y largate andrea

  383. blanca Dice:

    fuera e

  384. andrea Dice:

    tu no me das ordenes
    y tu deberias irte

  385. mario Dice:


  386. barbie Dice:

    pues no creas que vas ganando por que somos 3 contra1

  387. barbie Dice:

    y ahora que heee

  388. blanca Dice:

    bla bla bla fuera las dos esto no va con vosotras

  389. barbie Dice:

    me parece que deverias irte tu

  390. barbie Dice:

    olle que tambien esta mario

  391. mario Dice:

    tu eres la qe deberia irse niña de poco pelo

  392. andrea Dice:

    eso somos tres contra dos y mario tiene razon tienes poco pelo
    no contestes a mi respuesta

  393. blanca Dice:

    gilis los tres y tu mas barbie eres tu la qe tiene poco pelo

  394. blanca Dice:

    largaos los tres
    y fuera

  395. barbie Dice:

    hoy si me vieses en la realidad como te arrepentirias de tus palabras

  396. mario Dice:

    no te metas con ella tiene mas pelo qe tu

  397. barbie Dice:

    eso lo dices por que vas perdiendo y no tee gusta la derrota

  398. barbie Dice:


  399. blanca Dice:

    muy bien barbie cual es tu verdadero nombre

  400. blanca Dice:

    e barbie cual es tu verdadero nombre

  401. barbie Dice:

    y si no quiero decirtelo

  402. blanca Dice:

    vaya te as rendido soy la mejor

  403. barbie Dice:

    no me e rendido tu te has rendido en todo caso y eres laq peor james es el mejor

  404. blanca Dice:

    y tu amigo tambien
    ja sois inveciles

  405. blanca Dice:

    me voy

  406. barbie Dice:

    correcion tu eres estupida y mi amigo no a dicho nada para rendirse

  407. barbie Dice:

    ya terindes

  408. ana Dice:

    esa blanca tiene la minima razon sois estupidos

  409. barbie Dice:

    como ves que no puedes te vas sin decir nada

  410. barbie Dice:

    tu eres la estupida esta es una pagina web de fans de james maslow y no bienen a criticarlo

  411. mario Dice:

    eee tu estas de acuerdo con esa blanca

  412. barbie Dice:

    correccion eeee tu estas deacuerdo con esa estupida

  413. blanca Dice:

    claro qe si
    y callate

  414. mario Dice:

    mira qien a vuelto

  415. barbie Dice:

    la listilla estupida del grupo

  416. blanca Dice:

    porque teneis miedo bua bua

  417. blanca Dice:


  418. barbie Dice:

    no, esque te te tenemos asco

  419. blanca Dice:

    qe estupida blanca yo no soy estupida y ya se tu nombre es blanca verdad

  420. barbie Dice:

    no ese no es mi nombre

  421. barbie Dice:

    hoy que plof

  422. blanca Dice:

    me e fijado en lo qe puso james el estupido

  423. barbie Dice:

    asi que tu tambien lo leiste

  424. blanca Dice:

    si entonces porqe james dice tu nombre porqe te ablaba a ti plof

  425. barbie Dice:

    lo lees por que tienes envidia

  426. blanca Dice:

    vas a llorar a qe estas en hoymail

  427. barbie Dice:


  428. blanca Dice:

    con mario

  429. barbie Dice:

    que estas diciendo explicate mejor

  430. blanca Dice:

    qe importa la caligrafia ay bueno sois unos hijos de piiii

  431. blanca Dice:

    y james mucho mas

  432. barbie Dice:

    jajaja la tonta sele a ido un cable

  433. barbie Dice:

    yjames mucho mas listo

  434. barbie Dice:

    buen cantante

  435. barbie Dice:


  436. mario Dice:

    pues qe voten todos los qe creen qe james es el mejor qe digan siiiii
    todos los qe crean qe james es el peor qe digan no

  437. blanca Dice:

    por mi bien

  438. barbie Dice:


  439. barbie Dice:

    james es el mejor

  440. blanca Dice:

    bueno solo es un voto

  441. barbie Dice:

    me pareca que alfin blanca se a ido

  442. barbie Dice:

    pero vamos 1 a 0

  443. blanca Dice:

    pero si gano tendreis qe estar en mi bando

  444. barbie Dice:

    por que y si no queremos

  445. mario Dice:

    y si ganamos

  446. blanca Dice:

    si ganais james maslow tendra qe besar a blanca

  447. barbie Dice:

    vamos a ganar

  448. barbie Dice:

    como si no me a visto en la realidad

  449. blanca Dice:

    osea a barbie

  450. barbie Dice:

    ya pero como

  451. blanca Dice:

    da igual pero as ablado con el nos vemos la proxima semana

  452. blanca Dice:

    y recordad
    os vais a unir a mi banda porqe van a votar no

  453. barbie Dice:

    adios yo me conecto tos los dias

  454. barbie Dice:

    van a votar si

  455. blanca Dice:

    a si
    entonces quieres qe se aga la apuesta muy bien nos
    bemos la proxima semana

  456. barbie Dice:


  457. mario Dice:

    seguraaa qe tonta todo el mundo quiere a james maslow

  458. barbie Dice:

    si ees verdad

  459. blanca Dice:

    blanca e tenido una idea qe va a acer qe perdais decir amigos lo de james maslow y qe e yos se lo digan a sus amigos

  460. James Maslow Dice:

    Os quiero mucho a todas mis fans.

  461. blanca Dice:

    y tu qe idea as tenido e blanca

  462. luisa Dice:

    james el mejor

  463. barbie Dice:

    no te lo quiero decir

  464. luisa Dice:

    yo voto qe si

  465. barbie Dice:


  466. barbie Dice:

    ya vamos 3 a 1

  467. barbie Dice:

    como te sientes blanca

  468. rocio Dice:

    digo qe si

  469. barbie Dice:

    gracias rocio

  470. barbie Dice:

    4 a 1

  471. andrea Dice:

    yo digo que no

  472. maria Dice:

    yo lo voy a decir es qe no

  473. barbie Dice:

    por que malas, si james es el mejor

  474. barbie Dice:

    3 a 4

  475. rebeca Dice:

    es muy feo asi qedigo qe no

  476. barbie Dice:

    4 a 4 empate

  477. alba Dice:

    es asaqeroso asi qe voto no

  478. barbie Dice:

    por que
    el no es asqueroso es guapo

  479. barbie Dice:

    5 a 4

  480. blanca Dice:

    es guapisimo digo qe si

  481. barbie Dice:

    muchas gracias tu si que vales

  482. barbie Dice:

    5 a 5 empate(otra vez)

  483. blanca Dice:

    yo digo qe si porqe es el mejor ssiisisis

  484. barbie Dice:

    muy bien blanca asi megusta gracias

  485. barbie Dice:

    6 a 5

  486. mario2 Dice:

    yo qiero decir qe si

  487. barbie Dice:

    gracias mario 2

  488. barbie Dice:

    7 a 5

  489. barbie Dice:


  490. lucia Dice:

    es el meejjoorrcciittoo digo qe si

  491. jugo Dice:

    es el por digo qe no y no

  492. barbie Dice:

    9 a 6

  493. morganita60 Dice:

    es guapo por eso digo qe si

  494. barbie Dice:

    gracias morganita60

  495. barbie Dice:

    9 a 6 que bien

  496. blanca Dice:

    es es digo digo qe qe si si

  497. barbie Dice:

    gracias gracias

  498. barbie Dice:

    10 a 6

  499. lola Dice:

    si si si digo si

  500. barbie Dice:

    11 a 6

  501. barbie Dice:

    muchas gracias

  502. lisa Dice:

    si si es mas digo si

  503. barbie Dice:

    gracias lisa eres la mejor

  504. barbie Dice:

    12 a 6

  505. monica Dice:

    es si digo digo si

  506. barbie Dice:

    el doble que bien

  507. barbie Dice:

    13 a 6 que bien monica gracias

  508. barbie Dice:

    mas del doble gracias a ti monica

  509. paula Dice:

    si osea digo si para no complicar

  510. perla Dice:


  511. mario Dice:

    si bien echo paula y todas las qe estais votando

  512. mario Dice:

    si bien echo paula y todas las qe estais votando muy bien

  513. pablo Dice:

    es feo

  514. javier Dice:

    no lo quiero digo no

  515. antonio Dice:

    yo lo qe voy a decir es

  516. patricia Dice:

    no me gusta y tengo qe votar qe no

  517. patricio Dice:

    no lo siento por eso voto no

  518. marina Dice:

    es demasiado feo digo no

  519. blanca Dice:

    vaya vaya mira si son mario y blanca qe intentando reunir votos
    si vamos 20 a 20 para qe e y ademas es asta 50 asi qe poneos
    cualquier cosa aunqe mi ropa de mi bando sera mejor de lo qe lleveis

  520. laura Dice:

    digo no por por qe no

  521. blanca Dice:

    sientes la rabia blanca

  522. barbie Dice:

    segurisiomo vamos a ganar seguro

  523. barbie Dice:

    sientela tu por que aun no se sabe quien es el ganador

  524. blanca Dice:


  525. blanca Dice:

    digo yo si y requetesi

  526. barbie Dice:

    si riete mientras puedas

  527. barbie Dice:

    gracias blanca

  528. barbie Dice:

    ya vamos empate

  529. barbie Dice:

    22 a 22

  530. lucia Dice:

    bueno es el mejor digo qe si

  531. marina Dice:

    si a blanca o a mario le gusta los pokemon digo si

  532. barbie Dice:

    restifico 23 a 22

  533. barbie Dice:

    a mi sime gustan estan muy chulos tengo el pokemon diamante para la ds

  534. blanca Dice:

    no les gustan los pokemon a mario ni a blanca

  535. barbie Dice:

    si nos gustan tu que sabes ami me gustan pero a mario le encantan nadie sabe mas de pokemons que mario

  536. marina Dice:

    no les gustan jo digo no

  537. barbie Dice:

    hazle alguna pregunta ya veras

  538. barbie Dice:

    que si nos gustan es que blanca es una mentirosa que no quiere que consigamos votos

  539. chicafeliz Dice:

    yo yo yo yo yo yo si si si

  540. blanca Dice:

    eee si votais no james maslow vendra a mi casa con todas vosotras

  541. barbie Dice:

    gracias chica feliz tu me has echo feliz

  542. blanca Dice:

    retiro lo dicho james es feo enserio

  543. barbie Dice:

    no le voteis es una trampa votar si por que si osgusta por que a ellla no le gusta es mala y tonta

  544. barbie Dice:

    sabia que no aguantarias

  545. marina Dice:

    james no gustarme voto a no

  546. barbie Dice:

    vamos ganando por 2 puntos

  547. barbie Dice:

    26 a 25

  548. blanca Dice:

    ahora qe blanca jajajaja

  549. lisa Dice:

    me quito de si y me voy a no

  550. barbie Dice:

    pero aun vamos ganado

  551. barbie Dice:

    por que lisa si estabas muy bien con el si

  552. mario Dice:

    si qereis recibir un beso de james pues elegid si

  553. barbie Dice:

    lisa vuelve

  554. lisa Dice:

    me voy a si

  555. blanca Dice:

    me meto en el si

  556. blanca Dice:

    muy bien vais ganando pero esto no acabara asi os pienso ganar

  557. barbie Dice:

    blanca que ya vamos 21 a 29

  558. barbie Dice:

    eso ya se vera al final

  559. blanca Dice:

    bua bua bua bua bua bua bua bua bua bua bua bua bua bua bua bua bua bua

  560. blanca Dice:

    blanca una amiga mia se llama irene lopez perez

  561. barbie Dice:

    y que pasa con tu amiga

  562. barbie Dice:

    y que pasa con tu amigaguita que le pasa

  563. blanca Dice:

    blanca cual es tu mejor amiga

  564. barbie Dice:

    se llama cristina lozano bautista

  565. barbie Dice:

    la tulla es irene no

  566. blanca Dice:

    vaya precisamente esa es una de mis amiga enserio

  567. barbie Dice:


  568. blanca Dice:

    gracias aora se como detrozarte la vida

  569. maria Dice:

    yo digo qe james es guapo y digo qe si

  570. barbie Dice:


  571. barbie Dice:

    30 a 21

  572. barbie Dice:

    gracias maria

  573. barbie Dice:

    vamos ganado

  574. marina Dice:

    yo voto y vuelvo a vota si

  575. barbie Dice:

    gracias marina gracias a ti vamos 31 a 21

  576. ana Dice:

    me gustaria votar si

  577. marla Dice:

    voto para blanca y mario

  578. marta Dice:

    me encanta james mi voto es para mario

  579. barbie Dice:

    33 a 21

  580. barbie Dice:

    34 a 21

  581. barbie Dice:

    gracias atodas las que habis votado si wooo

  582. mario Dice:

    yo digo qe si e si

  583. barbie Dice:

    gracias mario

  584. jorge Dice:

    mi precioso voto es para mario y blanca y es verdad

  585. barbie Dice:

    35 a 21

  586. barbie Dice:

    gracias jorge gracias a tia vamos 36 a 21

  587. blanca Dice:

    bueno voy perdiendo por unos simplones

  588. barbie Dice:

    a que te refieres con simplones

  589. blanca Dice:

    voto a blanca y mario

  590. rocio Dice:

    si es mi voto

  591. rebeca Dice:

    este especial es para mario y barbie

  592. barbie Dice:

    ya vamos 37 a 21

  593. paula Dice:

    si es lo qe voto

  594. barbie Dice:

    ya vamos 40 a 21

  595. dulce Dice:

    somos 9 y votamos si

  596. maritere Dice:

    voto a si

  597. barbie Dice:

    si pos entonces somos 49 sis y 21 no

  598. blanca Dice:

    ee perdido nnnnoooo

  599. barbie Dice:

    gracias ati maritere emos ganao los sis

  600. mario Dice:

    ssssssiiiiiiii lo siento pues no lo siento

  601. barbie Dice:

    blanca hemos ganado

  602. blanca Dice:

    un trato es un trato

  603. barbie Dice:

    y que vas a hacer e perdedora

  604. blanca Dice:

    te dire en qe consiste
    es en un beso internet ay qe poner un lavio y un corazon y escribir yo tambiem

  605. barbie Dice:

    no el trato no era un beso internet era un beso asi que tienes que conseguirme un beso con james

  606. barbie Dice:


  607. blanca Dice:

    o que

  608. barbie Dice:

    nada sin querer lo puse

  609. blanca Dice:

    y dimelo rapidito

  610. mario Dice:

    e si es blanca qe y nuestro premio

  611. barbie Dice:

    ya te lo he dicho y no te pongas chulica

  612. barbie Dice:

    eso eso

  613. blanca Dice:

    ya le e dicho a tu amiga lo qe tiene qe acer

  614. mario Dice:

    e y mi premio

  615. barbie Dice:

    era un beso beso no un beso internet

  616. barbie Dice:

    y el premio de mario

  617. blanca Dice:

    tu premio pues besa a blanca y ya esta entendido

  618. mario Dice:

    pos haztelo tu misma

  619. barbie Dice:

    para tu informacion eso no es ningun premio eso esun castigo

  620. mario Dice:

    listilla y ni se te ocurra contestar con tus tonterias

  621. blanca Dice:

    si es un premio jajajaja

  622. barbie Dice:


  623. mario Dice:

    quieres saber lo que es un premio metete tu fofo trasero por
    la boca y asi no ablas

  624. blanca Dice:

    blanca te as quedado muda jajaja

  625. blanca Dice:

    si muy muda

  626. barbie Dice:

    no estoy muda tu si

  627. blanca Dice:

    yo voto a los sis

  628. andrea Dice:

    inma y yo votamos sis

  629. ines Dice:

    qui quiero votar sis

  630. blanca Dice:

    no sean acabado las votaciones y no es mentira
    lo juro

  631. ana Dice:

    voto a a sis

  632. morgan Dice:

    voto a todos sis

  633. barbie Dice:

    no digo que no digais que os gusta o que no hos gusta james pero ya se an acabado las votasciones y han ganado los siis

  634. luna Dice:

    votos de 12 amigos a si

  635. barbie Dice:

    por que todos sabemos que james es el mejor

  636. barbie Dice:

    luna se han cerrado ya las votacionecx por que hay ganador

  637. runa Dice:

    voto por mis 3 amigos si

  638. (L) Dice:

    yo digo a si sis

  639. barbie Dice:

    blanca ahora quien se a quedado muda

  640. mario Dice:

    se an acabado los votos VALE

  641. luna Dice:


  642. runa Dice:

    perdon pero si se an acabado

  643. (L) Dice:

    no abia qe votar
    lo siento

  644. blanca Dice:

    esperad volved nooooooo

  645. blanca Dice:


  646. barbie Dice:

    que pasa blanca

  647. blanca Dice:

    quiero ganar a blanca

  648. barbie Dice:

    en que como para que

  649. blanca Dice:


  650. barbie Dice:

    que pasa

  651. blanca Dice:

    oye tienes un admirador secreto blanca

  652. barbie Dice:


  653. blanca Dice:

    adivinalo con las cartas me voy

  654. barbie Dice:

    que cartas

  655. blanca Dice:

    y eso es todo si necesitas ayuda pidemela o a mario qe el sabe quien es

  656. blanca Dice:

    y por cierto quieres a alguien aparte de james
    maslow dire qe james es el mejor

  657. barbie Dice:

    como que si te digo si estoy enamorada de alguien tu diras que james es el mejor

  658. barbie Dice:

    es eso

  659. blanca Dice:

    pues no

  660. blanca Dice:

    y no llores

  661. barbie Dice:

    como que no llore no estoy llorando y si no es asi que es lo que has dicho

  662. blanca Dice:

    blanca blnca

  663. barbie Dice:

    que que

  664. blanca Dice:

    no ai nadie

  665. blanca Dice:


  666. barbie Dice:

    si estoy yo y mario

  667. blanca Dice:

    blanca si estas contesta

  668. blanca Dice:

    quieres qe seamos amigas tu no mario

  669. barbie Dice:


  670. barbie Dice:

    mmm… no se supone que eramos enemigas

  671. blanca Dice:

    por fi dimelo mañana qe me voy

  672. barbie Dice:

    si digo si pero mañana lo hablamos por la mañana buenas nhces

  673. blanca Dice:

    ee qe me dices

  674. blanca Dice:

    james es feisimo y as queroso

  675. barbie Dice:


  676. barbie Dice:

    como tu quizas

  677. blanca Dice:

    tu lo eres mas

  678. barbie Dice:

    no por que quien lo dice lo es

  679. blanca Dice:

    luego hablamos

  680. barbie Dice:

    no por que quien lo dice lo es lista

  681. barbie Dice:

    por quee a donde vas

  682. dana Dice:

    Hola james eres bello y no tenemos. Nada en comun no me gusta el deporte pero me gusta uno solo que es el sorf quisiera conosorte espero que den un solo concierto en caracas soy de venezuela me encanta cantar se actuar y me encantan tus ojos tus labios tu naris tu cuerpo tu mano tu pelo yo los acaba de conocer hace una semana y me encantaste solo espero que leas este comentario te lo pido te amooooo y por ti ariaaaa lo que sea te amare asta el fin del mundo te escribo todoo esto porque
    Nunca llegare a conocerte te amoooo

  683. Mario Dice:

    quien quiere a ¡¡JAMES MASLOW!!

  684. blanca Dice:

    volvamos a acer votos
    pero de negatividad y positivo

  685. Mario Dice:

    no lo se se lo preguntare a barbie vale

  686. barbie Dice:

    que decis a que te refieres blanca

  687. mario Dice:

    lo aremos

  688. blanca Dice:

    hay votos venga votar

  689. barbie Dice:

    yo no he dicho na que es eso de los votos positivos y negativos

  690. blanca Dice:

    estais seguros o no quereis

  691. mario Dice:

    a lo mejor quiere barbie o no quiere
    se lo pregunto

  692. barbie Dice:

    primero decidme que son los votos positivos y que son los votos negativos y luego ya dire eso si hay o no hay votos

  693. chicafeliz Dice:

    es guapo guapo esto es una cosa positiva

  694. barbie Dice:

    gracias chicafeliz

  695. barbie Dice:

    eres muy positiva

  696. marina Dice:

    bueno esta muy bueno pero barbie no se lo merece me merece a mi
    es una cosa positiva

  697. barbie Dice:

    gracias por el punto positivo pero eso de merecer o noo merecer eso lo decedira james

  698. andrea Dice:

    es verdad no se lo merece es a mi quien me merece

  699. barbie Dice:

    5 a 1
    y eso ya lo veremos moninas yo no digo nada es james quien decidira eso

  700. runa Dice:

    barbie buscate otro novio por qe este es mio

  701. blanca Dice:

    bueno yo opino lo mismo barbie no se merece a este chico de james

  702. chicafeliz Dice:

    ¿enserio?bueno yo tambien digo que no se merece y nunca se merecera a mi james

  703. patricia Dice:

    mucha razon teneis

  704. barbie Dice:

    si que me merece por que si no yo no estaria haciendo todo esto por el
    por que le quiero y vosotras no y yo lo defiendo vosotras solo os peleais por el sin defenderlo ni nada

  705. barbie Dice:

    bueno esas decisiones son buestras y no me meto en lo que penseis pero decid si las de un comentario positivo y no las de un comentario negativo

  706. andrea Dice:


  707. andrea Dice:


  708. BRENDA Dice:

    como esta eso de q a LOGAN se le bajo el azucar pobecito lo amoooooooo y es el mas lindo y pobre del q diga lo contrari¡¡¡¡

  709. PAOLA Dice:


  710. ANDREA Dice:



  711. paula Dice:

    muchas razones barbie no tiene posivilidades

  712. barbie Dice:

    ¿esos son comentarios positivos?

  713. barbie Dice:

    de que no tengo posibilidades pailita mia

  714. barbie Dice:

    vamos 8 a 1 creo bamos ganando los positivos,las super fans dejames maslow ,las mejores

  715. james maslow Dice:

    dear fans: Thanks to all, but do not have to fight, if there are some who think I’m cool I thank you, or else I try not to criticize things obscene comment, just me I have to translate everything I say so from Spanish to English to understand. BTR love our fans they are the best.
    watch the Christmas special BTR.
    hugs and kisses

  716. mario Dice:

    james ya sabemos qe ay un special de navidad de BTR pero estos votos lo acemos para qe sepan qe eres un buen cantante,aunqe tienes razon

  717. barbie Dice:

    si es verdad y yo lo voy a ver

  718. mario Dice:

    el qe vas a ver

  719. barbie Dice:

    pos de que estamos hablando del especial de navidad de big time rush asi que que es lo que puedo ver

  720. mario Dice:

    una pregunta james

  721. mario Dice:

    en este episodio de hoy parece qe te desmayabas

  722. PAOLA Dice:


  723. barbie Dice:

    mmm… a que a venido eso

  724. lesly Dice:

    q lindo es y canta excelente

  725. barbie Dice:

    tienes razon lesly

  726. agostina Dice:

    hola james soy tu mayor fan tenemos tantas cosas en comun eres muy guapo desde k lleve a argentina y cuando te vi en la television sabia k eras super guapo por FAVOR SI NESECITAS ALGO DIMELO ,chao te admiro mucho.

  727. ximena Dice:

    i James te aamooooooo!
    i casate con migo !

  728. ximena Dice:

    eres tan guapo JAMES . soy tu fan N.1 yo quisiera ablar con tigo pero por desgrasia no ablas español . I LOVE YUO JAMES

  729. barbie Dice:

    no eres la unica fan nº1 que quiere conocerlo

  730. mario Dice:

    no me extraña qe blanca odie a james

  731. blanca Dice:

    siiiiii tu amigo o novio jaajjaaaj se a unido a mi

  732. blanca Dice:

    bueno tu quieres a james perdon

  733. barbie Dice:

    no es mi novio y no se a unido ati

  734. barbie Dice:

    si por eso

  735. blanca Dice:

    si es tu novio jajajajajajajajajajajajajajaja
    si lo es si lo es jajajajajajajajajajajaja

  736. chiara Dice:

    james no sabes cuanto te amoo sos el mejor hermosooooooooooo…y por eso te hise esta canción

  737. jame Dice:

    jame soy tu fans numero 1 tengo todas tus canciones para mi sos mas hermoso q justin bieber me se todas tus canciones sos lo mas jame siempre quise ser como vos ;)

  738. blanca Dice:

    no sabeis na las dos de james es penoso

  739. Ale Dice:

    tenemos muchas cosas en comun a mi me encanta los deportes me gusta el color verde.. y chicas (las fanaticas de james) si se fijan bien en el cuello de james en la parte derecha tiene un lunar mediano y yo tambien tengo un lunar ahi

  740. Ale Dice:

    tenemos muchas cosas en comun a mi me encanta los deportes me gusta el color verde.. y chicas (las fanaticas de james) si se fijan bien en el cuello (de cualquier foto de cara) de james en la parte derecha tiene un lunar mediano y yo tambien tengo un lunar ahi

  741. claudia Dice:

    james a mi hermana de 12 años le encantas y ama a btr igual que yo amo a btr para mi los 4 son los mas guapos del planeta amo a btr nunca se separen

  742. sofia Dice:

    hola me llamo sofia ojala vengas a mexico soy tu fan numero1
    eres el mas lindo de los cuatro te quiero muchisisisisisisisi
    simo y vengas un dia a mi casa y te quedes un dia



  743. lucy Dice:

    todas estan mal ustedes no deciden si se quedan con el ,el las escoje a ustedes y creen que tendra tiempo de conocerlas antes se volvera loco y si no ya estara juvilado.
    piensen un poco cuantas oportunidades hay de que las conosca ,siempre rodeado
    de guardias y a un mas cantidad de fanaticas que ustedes.

  744. lucia Dice:

    No se de que ablas por que tengo 20 y todabia no pierdo las esperansas de que
    venga a Uruguay y lo pueda conocer en persona lo mas que amo soy la fan n 1 en el universo infinito

  745. lucia Dice:

    ademas olbide mencionar que canto muy bien, actuo tan bien que convensi a mi maestra de 3 de que me havia muerto con un valaso en la cintura y vailo muy bien
    a todas esas cosas las ago bien por que ademas de deicarle tiempo al cole tambien le dedico mucho tiempo a actuar, vailar y cantar .todo lo empese a hacer desde que tengo 3 años y tengo todas las canciones de la vanda lo amo mucho a james

  746. c@mil Dice:

    James tengo una amiga que es muy tierna y amable es super fan tuya y no creas que soy yo ok pero bueno sólo quería que supieras que ella tiene taaaaaaaaaaaaaaaaaaaaaantooooo en común contigo y no deja de hablar de ti pero ya que ilove james dice mi bff

  747. andrea Dice:

    callate lucy tu no piensas vieja presumida

  748. jenny Dice:

    Hola como estas espero que estes bien te amo soy tú fan la mejor de todas cuando vas a venir a mexicali con tus amijos logan kendall y Carlos y tú también ilove

  749. mario Dice:

    si,pues espera setada por que james vive en Nueva York y le va a costar llegar ahi

  750. james maslow Dice:

    hey guys happy new year everybody.
    what’s up?
    thanks so much, for the comments and dear fans: Thanks to all, but do not have to fight, if there are some who think I’m cool I thank you, or else I try not to criticize things obscene comment, just me I have to translate everything I say so from Spanish to English to understand. BTR love our fans they are the best.

  751. elias Dice:

    quisiera conocerte en persona quiero que bengan a mexico porque llo vivo en puebla y en mexico es donde me que da mas cerca y que ustedes baalllan alla a un concierto y conocerlos a los cuatro

  752. mariana Dice:

    james yo no tengo cosas en comun pero yo te amo y si me conosieras nunca te vas a arepentir de averme conosido te amo

  753. alejandra Dice:

    te amo james eres muy guapo te adoro daria todo por ser tu novia

  754. tamara Dice:

    james es guapo <3 te adoro
    james <3 <3

  755. jennifer stewart Dice:

    omg! James eres el mejor de los cuatro amo cuando te vi por primera vez eres super cool! se que sin ti Btr no tendria el estilo que tienen ahora tenemos TODO en comun tengo una amiga como carlos, logan y kendal y yo seria como tu pero en femenino xD
    ojala sigan asi
    jennifer stewart

  756. janet Dice:

    james soslo+ te kiero mucho eres muy lindo:D ♥♥♥♥♥♥♥

  757. nayeli Dice:

    james eres el chavo mas guapo que e visto me encantas eres el mas guapo de BTR te amo eres lo maximo

    TE AMO
    I LOVE

  758. nayeli Dice:

    JAMES tu y yo seremos compatibles porque somos cancer y somos del mes de julio que lindo Te Amo

  759. giorgiana rebeca radu Dice:

    hello, james, my name is rebeca and, y hope, some day, meet you. you so beautiful, and sexi, and some day i wish see you ut mi eice, meet, and heer you sin, boyfriend. good lock. remember, you are a victori, and bee yourself, and never change, and you never say never, fight for what do you whant,. i love you

  760. grecia Dice:

    hola como estan todos los amo

  761. erick Dice:

    james eres bueno cantando te admiro me gustaria ser como tu……………………… BTR
    es increible

  762. barbara Dice:

    james te amo ojala y vengas a torreon para verte

  763. alicia Dice:


  764. Vale_Rusher Dice:

    Yo Ser Rusher ! :D

  765. Vale_Rusher Dice:


  766. andrea ilian Dice:

    bueno yo quiero desir q la verdad no tengo tantas casas en comun con james no me gusta el futbol el color verde es mi 7 color favorito no tengo un cicatriz en el codo como james ni mucho menos voy a desir q lo conosco por q yo se q no es verdad . Pero tambien quiero desir le algo a mierda james SI TIES VIDA PROPIA USA LA Y DEJANOS TRANQUILAS ES NUESTRO PROBLEMA SI NO TENEMOS VIDA PROPI NO CRES ASI Q PRIMERO RESPETATE Y RESPETANOS SI QUIERS SER RESPETADO


  767. yaneli maslow Dice:

    me gustas tengo 10 años soy cancer y me llamo yanelimaslow naci el 27 de julio del 2011 me tienes de amiga en el facebook mi cancion favorita es b.t.r me gusta el color negro me gusta montar caballo gane 5 trofeos de futbol y basquetbol

  768. mily Dice:

    hla I am a big miracles call you and you kiero fans ss the world’s cutest i that nobody is going to change amoooooooooooo you! I like the green I like the basquebooll and volleyball butboll besoss bye
    =) <3 <3 <3

  769. andrea ilian Dice:

    hola Yaneli maslow si sabes q si ubiieras nacido el 27 de junio de 2011 tendrias 1 año con 7 meses¿

    atte andrea ilian

  770. pepe Dice:

    es eeeeeeeeeeeeeeeeeeeeeeeeeeeeeellllllllllllll meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeejjjjjjjjjjjjjjjjjjjjooor de big time rush quisiera ser como el

  771. jared Dice:

    El Es el mejor de todos de los de nick quisiera ser como el soy identico

  772. valeria Dice:

    yo creo que logan es el mas lindo de big time rush porque tiene locas a las chicas te amo logan eres el mejor

  773. valeria d´ maslow Dice:

    te ammiii merry me james i love you eres el mejor y el dia qe te conosca me ire contigo jhajajajahajha me encata tu cerpo y tus abdominales de acero

  774. dayana Dice:

    hola james eres muy lindo y lo mejor de ti es tu sonrisa,eres mi inspiracion para levantarme todos los dias, cuidate mucho bye

  775. África Dice:

    Oooooh James I love you so much !
    I want to meet you !
    I’m a big fan of BTR <333333
    You are very very pretty, and, grrrrr Ilove You
    I LIVE VERY VERY NEAR OF YOU <3333333333

  776. sarah Dice:

    la neta todasz zon una vola d mensaz x k piensan y creen k james algun dia va a ver est0o y les va allamar buen0o es0o lo dig0o para kn deja zu numer0o k idiotas james nunca va aserlesz cas0o nunca x k el es un artista muy ocupad0o y no tn tmpo para ver comentari’00osz estupids0oz y pendej0osz aszii para k no duigan d k ayy tenem0osz cosas en comun aszi k no c gan ilucionesz falsaz nop sean taradas de atir0o estan bn pendejasz y esupidas zalud0osz perdedorasz

  777. james maslow Dice:

    Hey guys what’s up?
    thanks so much, for the comments and dear fans: Thanks to all, but do not have to fight, if there are some who think I’m cool I thank you, or else I try not to criticize things obscene comment, just me I have to translate everything I say so from Spanish to English to understand. BTR love our fans they are the best.

  778. Susana Dice:

    MMM miren si le van a decir que lo aman que sea su novio y le dejan el numero…. les recuerdo que el habla ingles! no español par de idiotas!

  779. vilehyn Dice:

    james eres guapisimo y cantas super lindo

  780. daniela loreto Dice:

    james te amo eres el mejor ojala que algun dia llengen en una gira al estado de chihuahua y poder conoserte

  781. denise Dice:

    Ers errrrrrmoso james sos rerrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr lindooooooooooooooooooooooooooooooooooooo

  782. maria Dice:

    james dile a tu manager que vengan a bogota colombia

  783. Elaiza D``Henderson Dice:

    te quisiera conocer aver si en realidad eres asi de lindo pork no creo ke tengas la boquita rosada ni el cabello asi pero me caes flaco como quieras ven ala R.Dpara k yo te vea lo quisiera conoser alos 4 T.K.M.

  784. elizabeth Dice:

    james te amo eres el amor de mi vida y mi gran sueño es poder conocerte en persona tenemos tantas cosas en común soy tu chica ideal y otro de mi mas grande sueños es poder besarte i love james maslow <3 <3

  785. camilita Dice:

    me encantaria conocerte seria muy chebre ojala pudieras venir a colombia que tristeza que no tengamos mucho en comun pero igual sigues siendo especial <3 ojala te pudiera conocer seria maravilloso =D

  786. jik Dice:

    te amo soy tu myor fan estoi en esta pagina orke me dejaron sacra una biografia de un artista y te eligi a ti

  787. lucero Dice:

    Pinches idiotas dejen de publicar sus pendejadas blanca y barbel. Tttttttttttttttttteeeeeeeeeeeeeeeeee aaaaaaaaaaammmmmmmooooooo jjjjjjjjjjjjaaaaaaaaaammmmmmmeeeeeeeeessss……………………………..

  788. Mirella Dice:

    James, enserio te amo eres mi principe azul
    James, seriously I love you, you´re my prince charming

  789. juanita romiti Dice:

    james sos un amor sos el amor de mi vida mi sueño es poderte conoser que me des tu autograyo y un abraso te aaaaaaaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmmoooooooooo sos el mas lindo de big time rush te amo yo juanita romiti .

  790. juanita romiti Dice:

    JAMES si tubiera tu edad y dinero para ir a conoserte iria y te pediria matrimonio y te ccomeria de un beso

  791. fireblaze Dice:

    james maslow is coooooooooolllllllllllllllllllllllllllllllllllllll the most ccccccccoooooooooolllllllllllllllllllllllllllllllll

  792. camila Dice:

    james vo0s sos tan pero tan engrido pero igual sos wapo!!!!!!!

  793. James Maslow Dice:

    Hey, it may seem that I’m cocky but I’m not well, that’s my role in the series but I’m not like that.
    and thanks to each and everyone for the support they give us, and are the best, and we love

  794. paolitha rebolledo Dice:

    hello mi hermanitha te ama tu eres su nuevo mundo ella kisiera conocerte y darte un abrazo fuerte te ama tanto ke ve todos los dias big time rush

  795. vivi Dice:

    paolitha rebolledo vos desile a tu hermana ke yo y el nos vamos a casar estupida jajaja!!!!!!!!!!!!!!!!!!!!!!

  796. alejandra Dice:

    te cres super guapo pero en realidad estas super feo

  797. diana Dice:

    James wanted to meet you in person I am in Puebla and your in the us would like another look are in Mexico are giving a concert very cool very handsome and clever hopefully see another are in Mexico I’m translating it with google translator hopefully see another are in Mexico .
    My biggest dream is to be at a concert by Big Time Rush to know

  798. elias Dice:


  799. yasmin Dice:

    james eres el mejor te amo
    eres muy guapo y desde el primer dia
    que te vi me enamore

  800. jessy Dice:

    amo a james maslow s el chavo mas prfcto del universo s muy amable servisial y yo soy su fan # 1 aunq aorita lo ando investigando xq dicen q c casara con victoria justice y quiero q seamos novios y esposos te amo mi james ven a guate pliss !!!!!!!!!

  801. James Maslow Dice:

    Hello how are you? Here I spend to devote a few words: elias, you need not be like me. I think everyone has to believe in yourself and Jessy, Yasmin and Diana also love them.
    Well, I say goodbye and thank you all for support if you have any questions for me gladly answer them :)

  802. camila amarilla Dice:

    sera q vos sos james???????

  803. sister de james maslow Dice:

    hola soy la hermana de james maslow pero yo estoy de viaje por españa y se hablar perfectamente el español si teneis alguna pregunta sobre mi hermano preguntadmelo que se todo sobre el por que yo soy su hermana mayor

  804. camila amarilla Dice:

    yo solo pregunte si es james sera el jajajaja!!!!!
    no mentira le quiero a tu hermano!!!!!!!!!!!!!!!!!!!
    esta re lindo!!!!!!!!!!!

  805. valentina Dice:

    yo solo pregunto si es james sera el jajaajajajaja

  806. camila amarilla Dice:

    sera q vos sos su hermana lo dudo mucho eeeeeeehhhhhhhhh???????????’

  807. camila amarilla Dice:

    saves q sos una pesada valentina!!!!!!!!!!!!!!!!!!!!!!!!

  808. leidy Dice:


  809. dany Dice:

    JAMES MASLOW eres guapisimo que suertuda es MIRANDA CROWSCOW en tener un novio como tu

  810. adlinda Dice:

    ay james tu biografia me iso llorar por que es lo mismo que me gusta al igual que me gustas tu ojala me des pases vip para tu concierto si es ojala que vengas a corpus chistri grasias

  811. camila amarilla Dice:

    Q? miranda es su novia no puedo creer yo le amo a kendall pero mi amiga se muere ella le ama a james!!!!!!!!!!!!!!!!!
    la verdad q es mejor kendall mi amor!!!!!!!!!!!!!!!!!!

  812. diana maslow Dice:

    i love you jamesss!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  813. michell Dice:

    hola soy michell y ami me gusta el james creo que es muy guapo y somos compatibles todo lo que le gusta a el me gusta ami me encanta ver big time rush y tambien verlo en icarly es el mejor cantante y actris del mundo hay muchos pero como el no hay nadie lo amo i love you james

  814. camila amarilla Dice:

    michell para tu informacion se dice actor no actriz ok!!!!!!!!!!!!!!
    xq actriz son las mujeres!!!!!!!!!!!

  815. Daniella Maslow Dice:

    Te amoooo James tienes un super talento tengo 13 años , me encanta big time rush , tambn me encanta el color verde , eres super guapoO :D Soy tu fan 1° Te amoOOoooo <3 Quiero que sepas que aunque estes lejos siempre estas en mi corazón Te quiero Bye nne…!!

  816. greiss Dice:

    james tienes q hablar español nadie te entiende y si juego basquet y futbol a y solo te admiro mas bien solo quiero q me des tu correo

  817. camila amarilla Dice:

    tenes razon greiss!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!;D

  818. karla Dice:

    hola james soy tu fans número 1 solo quiero decirte que me gustas mucho y no me importa lo que digan las demas niñas pero se que tu alqunavez va a venir a México D.F JAMES TE AMO y no dejo de pensar en ti.
    quiero que sepas que tu y yo si tememos cosas en comun es la verdad mi color favoritos es el verde, me gustan los caballos, el futbol, el balonsesto,el basebol bailar, actuar y sobretodo cantar en mi cuarto y en mi cel tengo un monton de photos tuyas y no paro de hablar de ti y veo tus videos TE AMOOOOO TE AMO quiero que busques esta cancion TE LA DEDICO YO QUISIERA Reik y otra cancion que me gustaría que la buscaras POR QUE TU ERES TODO es de Julion Alvarez plis buscalos ATT:Karla Te dejo mi numero 5539259871 bye james

  819. karla Dice:

    James no le agas caso a LEIDY Kendall no es mejor que tu todas dice que tu eres el mas guapo de todos y el mejor ILOVE JAMES ENTENDISTE LEIDY

  820. karla Dice:

    m…. Sister de James Maslow quiciera saber si tu tienes facebook si tienes me podrías buscar? salgo como Karla Alquicira plis

  821. karla Dice:

    Alejandra el es super guapo y no se cre es mejor que todos

  822. camila amarilla Dice:

    aver karla yo creo q leidy tiene razon kendall es el mejor d la banda bueno james es lindo pero mas kendalll!!!!!!!!!!!!!!!!!!!!!!!!!!

  823. James Maslow Dice:

    Hi girls how are you?, Here I happened to answer any questions, I have no sisters I have two brothers and upon request of you… hola! Las amamos Mucho, y chicas no se peleen si? :) Thanks Karla, and all the girls want to make clear that I have no sister and my brothers are Phillip Maslow and Aly Thom. Las Amo <3 (I translated it from English to Spanish translator with the Internet and that some words in Spanish.)

  824. camila amarilla Dice:

    james i love speaking in spanish i love you =D

  825. xiomara cabrales Dice:

    lucy hernandez junco eres tu dimeeeeeeee

  826. xiomara cabrales Dice:

    dime eres tu lok

  827. xiomara cabrales Dice:

    hola camila amarilla dime como vas con la buelta q es tamo hasiendo

  828. camila amarilla Dice:

    aver ximara cabrales quien sos vos?

  829. kelly johanna Dice:

    james es el mas guapo de big time rush lo amo logan es el mas simpático de la banda espero que sigan haci los amo te amo james eres el mejor

  830. kelly johanna Dice:


  831. xiomara jimenez velasquez Dice:

    ja soy yo camila xiomara. j. v tu amiga de colombia q dime como seguimos con lo de kendall

  832. xiomara jimenez velasquez Dice:

    james is´´ love´´

  833. xiomara jimenez velasquez Dice:

    loco james

  834. xiomara jimenez velasquez Dice:

    eres simpatico

  835. camila amarilla Dice:

    todo bien ami revisa un poco tu face yo t envie solicitud!!!!!!!!!!

  836. lala Dice:

    i love james

  837. elias Dice:

    cuando vienen a mexico quisiera conocerlos en persona son geniales

  838. karla Dice:

    estas guapisimooooooooooooooooooooo :*

  839. rosa Dice:

    woooow james es un gupisimo actor y cantante espero q den un concierto en mexico df y wow me encanta james eres genial te amo

  840. eugenia Dice:

    te amooo james estas re divino sos un bombom!!!!!!!!!

  841. Regina Dice:

    James I realy love you you’re My super hero

  842. FERNANDA Dice:


  843. FERNANDA Dice:


  844. FERNANDA Dice:


  845. FERNANDA Dice:


  846. FERNANDA Dice:


  847. FERNANDA Dice:


  848. Mery Dice:

    Aw.. te amO james eres toDo.!! TAN liindo me encanta tu sonrisa..te amOoO!!

  849. paulina Dice:

    james te amo yo no tengo tantas cosas en comun con tigo pero me gusta el color verde te amo y espero conoserte algun dia te amo :)
    estas guapisimooooooooooooooooooooo * :)

  850. paulina Dice:




  852. ALEEX SCHIMDT Dice:


  853. camila amarilla Dice:

    kllat mejor vos aleex xq vos tapocono no sos aleex schmidt sos una perra y vos sos la penosa y si pued leer!!!!!!!!!!!!!!!!!!!!!
    q t qued grabado en tu kbeazaaaaaaaaaaaaa¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡HUECA!!!!!!!!!!!!!!!!!!!!!!!!

  854. camila amarilla Dice:


  855. jennifer stewart Dice:

    Haber chicas no peleen, acaso Alex Schmidt no es una Rusher verdadera… I love you James!! you’re so pretty

  856. andreaa Dice:

    james es el muchach0 mas guap3Riim0 d t0d0 el mund0 …… ¡ l0v3 y0u james!! es demaciad0 guap0 l0 am0….

  857. catalina garzon Dice:

    you are beatifull james first one come to colombia would give all the money in the world but know i love you much i love james i love youuuuuuuuuuuuuu i would marry yuo are perfect.

  858. kelly johanna Dice:

    te amo james eres el mas guapo de la banda te amo eres el perfecto de la banda espero que sigas haci te amo james eres lo maximo

  859. Maria Dice:

    Continua com a tua carreira que esta óptima, podes chegar ao topo.

  860. ailu Dice:

    sos hermoso no puedo crer que exista un chico tan pero tan lindo I love you !!! >3 >3 :)

  861. Fiamma Dice:

    ¡¡¡¡¡Te amo sos re lindo¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

  862. jenny sa Dice:

    Ola james yo soy tu mayor fan quisiera algun dia tomarme una foto con tigo y k me dieras un disco dew big time rush te amo. :D

  863. valentina Dice:

    hola James , yo te amo y yo complo años tres dias antes que vos y el verde es mi terser color favorito mi hermano cumple años el mismo dia que vos , no voy a pedirta que seas mi novio porque ya deves tener novia a demas de que solo tengo 11 años .James sos hermoso y lindo y ¡¡¡¡¡YO TE AMO !!!!!!

  864. valentina Dice:

    hola James , yo te amo y yo cumplo años tres dias antes que vos y el verde es mi terser color favorito mi hermano cumple años el mismo dia que vos , no voy a pedirte que seas mi novio porque ya deves tener novia a demas de que solo tengo 11 años .James sos hermoso y lindo y ¡¡¡¡¡YO TE AMO !!!!!! algun dia veni a Buenos Aires porque yo vivo ahi.

  865. menny y nalu de mashlow Dice:

    menny: hola james eres super guapooooooooooooooooooooooo ! TE AMOOOO

    nalu: eres super lindo te adoro ati y a tu musica eres muy hermoso! TE AMO! dile a logan henderson q lo amo mas q a ti!! es muy bello me ksare con el no esa sophia siguere!


  866. Fabi de Maslow Dice:

    lo amoooooooooooooooooooo un monton siiiiii <3 es el mejor lo amooo

  867. Perla Vazquez Dice:

    James…I just want to shere that I wiil be James wife and I over which all of you…DAMNED PROSTITUTES!!! (James hope you read this) I LOVE YOU

  868. brenda Dice:

    james es el mejor si…..
    las chicas dicen cosas pero el no entiende todas las cosas que ustedes no entienden,y ademas el abla en inglish.Y las chicas otra brenda como yo re copiona y la otra que se llamaba lalo decian nose cual de las dos desian que:a kendall le dicia que mejore la vos y la otra le dijo que tenga novia que si tene novia le decia el no las entienda al menos que sepa español y ya dejenloooo las dos son insoportable sin ofendeer pero si basta chicas dejenlo dios:p…….

    james estubiste well in all episodes not agas if the girls l say that there are selosas and that l have twelve years lolamento but first we will study to go see them

  869. brenda Dice:

    james es el mejor si…..
    las chicas dicen cosas pero el no entiende todas las cosas que ustedes no entienden,y ademas el abla en inglish.Y las chicas otra brenda como yo re copiona y la otra que se llamaba lalo decian nose cual de las dos desian que:a kendall le dicia que mejore la vos y la otra le dijo que tenga novia que si tene novia le decia el no las entienda al menos que sepa español y ya dejenloooo las dos son insoportable sin ofendeer pero si basta chicas dejenlo dios:p…….

    james estubiste well in all episodes not agas if the girls l say that there are selosas and that l have twelve years lolamento but first we will study to go see them may be in the consierto and l ” ll go where you live kisses see you soon first will study bye

  870. brenda Dice:

    james es el mejor si…..
    las chicas dicen cosas pero el no entiende todas las cosas que ustedes no entienden,y ademas el abla en inglish.Y las chicas otra brenda como yo re copiona y la otra que se llamaba lalo decian nose cual de las dos desian que:a kendall le dicia que mejore la vos y la otra le dijo que tenga novia que si tene novia le decia el no las entienda al menos que sepa español y ya dejenloooo las dos son insoportable sin ofendeer pero si basta chicas dejenlo dios:p…….

    james estubiste well in all episodes not agas if the girls l say that there are selosas and that l have twelve years lolamento but first we will study to go see them may be in the consierto and l ” ll go where you live kisses see you soon first will study

  871. paulina Dice:

    james te amo cuando veo tus fotos o big tan ruash no lo resisto eres el amor de mi vida claro logan ,kendal,y carlos estan guapos pero tu eres el mas guapo de todos los artistas q conosco tu eres el mas guapo como tu no ay 2 ni3 no ynadie como tu ¡TE AMO!¨;)

  872. Princessss susi Dice:


  873. andrea Dice:

    pues fijate que kendall si esta guapo pero no como james quien quiera que seas tienes un mal gusto a por cierto, i love james nunca te voy a olvidar nunka me pierdo los de big time rush aunque sean los mismos no me canso de verlos asi por cierto vere los nuevo capitulos, tqm, bueno en realidad me llamo diana, aaah y como me gustaria tener el mismo signo que tu me gustaria saber tu nombre completo bueno solo queria decir que te amo muxxo nunka e voy a olvidar


  874. andrea Dice:


  875. princesa del rock alias : marianna Dice:

    james tenemos muchas cosas en común tal vez no entiendas mi mensaje pero espero si yo también soy cáncer también tengo una cicatriz mis colores favoritos son como el color de cabello y tus ojos a y aparte el verde te james


  876. maira Dice:

    te amoo! sos hermoso!!!

  877. mili Dice:


  878. Jenny =o) Dice:

    wooooooooow tnmos cosas n comun teee adorooooooooooooop

  879. PALOMA Dice:


  880. alexa Dice:


  881. alexa Dice:


  882. guadalupe carballo herrera Dice:

    james es el chico mas guapo k he konocido en toda mi vida y juro k daria jualkier cosa por conocerlo en persona encerio kualkier kosa.
    TE AMO JAMES !!!!!!!!
    y juro k mas adelante me KASARE komtigo.eso lo juro y nuestros hijos se llamaran james, daniel y nosomi.
    o klaro k si tu kieres otro nombre no me importa le pondremos el nombre k tu kieras.TE AMO !!!!!! JAMES NO LO OLVIDES NUNK .
    espero k algun dia nos veamos en persona.
    TE AMO!!!! TE AMO!!!!!
    TE AMO!!!!!!!!!
    ERES INKREIBLE!!!!!!:)

  883. hilda guadalupe c.p Dice:

    james te adoro no sabes cuanto yo te veia cuando tenia cable
    pero te sigo recordando no sabes cuando pero ojala le digas a tu manager que vengan a hacer un concierto a puebla o a firmar autografos y a si se cumplira mi sueno de conocerte en persona pero lo mas importante es q te kiero

  884. hilda guadalupe c.p Dice:

    james te adoro daria cualquier cosa por ir a uno de tus conciertos cualquier csa
    enserio soy una fan loca por ti=)
    teeeeee amooooooo

  885. hilda guadalupe c.p Dice:

    vales mil james enserio eres el cantante mas guapo que e conocido en toda mi vidaaaaaa sabes como voy a gritar cuando vaya a uno de tus concierto ???
    i love jameeeeesss
    siiiii cooll jamesss
    100% love
    yo y tu

  886. hilda guadalupe c.p Dice:

    y quiero que me mandes un mail con tu face

  887. gaby y mariana d btr Dice:

    hello! q chico tan mas guapo pero en verdad megusta muchomas kendall pero bueno seme ases guapisimo ok :) arriba BTR ATT:GABY SU GRAN ATMIRADORA bueno ami tambien megustas pero logan me encanta esta guapisisisisimo bueno asdios loqro mil mariana su fan numero 1 tmxxxm BICITENOS MUYYYYYYYYYYYYYY PRONTO A MEXICO OK I LOVE JAMES,KENDALL,LOGANY CARLOS

  888. silvana Dice:

    amo a james mmmmmmmmmmmmmmmmmmmassssssssssssssssssssssssssssssssssssssssssssslllllllllllllllllllllllllllllllllllllllllllllllllllllooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooowwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww ccccccccccccccccccccccccccccccooooooooooooooooooooooooooooonnnnnnnnnnnnnnnnnnnnnnnnnnn tttttttttttttttttttttttttttttttttoooooooooooooooooooooooooooooooooooddddddddddddddddddddddddaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaalllllllllllllllllllllllllmmmmmmmmmmmmmmmmaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

  889. FERNANDA Dice:


  890. mili Dice:

    te amoooo

  891. mili Dice:

    te amoooo sossssssssssssss hermosooooooooooooooooooooooooo

  892. mili Dice:


  893. mili Dice:


  894. gaby Dice:

    james te amo !! te adoro sos lo mas … me encantaria conocerte alguna vez en persona .. aunque nose capaz que moriria si te veo en persona … te amo muchisimo te amoooooooooooo!!!!!

  895. jessenia Dice:

    eres muy talentoso
    espero que vengan a peru
    eres lindo
    aunque no tengamos tantas cosas en comun me encanta la musica y eres my cantante favorito
    I love you!!!

  896. ximena maslow Dice:

    esa tal PAU esta idiota dise q james esta del asco xk ella solo se fija en el bago q pasa x el frente de su casa james no le agas caso tu estas super lindo super guapo eres super sexi quisiera q vengan al df yo estoy chica pro siempre estare enamorada d ti TE AMO TE AMO TE AMO TE AMO

  897. concepcion Dice:

    te amooooooooooo james espero k alguna vez vinieras a mexico para poder conocerte en persona vivo en veracruz visitame

  898. angie murillo Dice:

    hola james te amo james bivo enmi amor tegucigalpa te espero mi amor ADIOS JAMES

  899. rake Dice:

    james te kiero muchisimo eres wapisimo¡¡¡

    te kiero muchooooooooooooooo wappo

  900. inma Dice:

    james te kiero muchisimo porke eres super wappo y tienes un cuerpazo


  901. inma Dice:

    love james love james te kiero mucho

    eres el amor de mi vida

  902. Hola Dice:

    Argentinas WEONAS el es mio … tenemos la misma edad, nos gustan y disgustan las mismas cosa …


  903. paulina Dice:


  904. paulina Dice:

    te amo bb eres el amor de mi vida :)

    es pero q ayas leid0 mis comentarios

  905. lupita Dice:

    james i love te ammooooo y etas bien sexy y guapo te amo i love

  906. yuliet tenorio Dice:

    james eres lo maximo no sabes cuanto daria por conocerte en persona te kiero mucho y ojala pudieran venir a mexico guadalajara jalisco te kiero mucho… abrasos y besos

    james you do not know how it would give maximum by meeting you and hopefully you kiero much could come to mexico guadalajara jalisco kiero you very much … hugs and kisses

  907. paulina Dice:

    james te amo estas cuericimooooooooo :)

  908. oriana Dice:

    a mi mejor amiga le encantas y y0 a logan

  909. andrea Dice:

    te odio pero estas guapo y tu musica me gusta

  910. Itzel Dice:

    te amo y espero poderte conocer pronto amo tu hermosa voz cantas como un angel

  911. paulina Dice:

    james te amo eres un rey espero q leas los comentarios

  912. LIZ Dice:



  913. LIZ Dice:


  914. paulina Dice:

    si te tubiera a mi lado y tu fueras una lagrima no yoraria para no perderte


  915. paula y james Dice:

    hello james you’re the best I hope someday you can know is to speak English if you know some day but I’m handsome Spanish

  916. Rusher 4 ever! Dice:

    Aaaaaaaaaaaah amor mio!

  917. micaela Dice:

    ♥♥♥♥I love you jame ♥♥♥♥ ‘re very cute on me Jor ♥♥

  918. miriam Dice:

    that this handsome

  919. ana Dice:

    te amo james eres un hermoso adorado niño con carita de angel

  920. katia lizeth Dice:

    la verdad james eres el chico mas guapo del mundo y te adoro sobre todo cuando sales en big time rush

  921. ginella Dice:

    james eres re lindo, me gusta como cantas y me gusta cuando tu pelo esta al viento en algunos video.me gustaria verte en persona y no por la tele, te digo que res el chico mas lindo que vi.me gustan los videos que hacen y mi hermana cuando escucha los videos canta muy contenta.
    james te adorooooooooooooooooooooo y te amooooooooooooooooo tengo todos tus posters bueno tengo mas fotos de vos solo y no de los cuatro.

    jamesssssssssssss te amooooooooooooooooooo ;)

  922. maggy Dice:

    io nasi el mismo dia q james i mi color favorito es el verde iwual q es de james lo amooooooo

  923. claudia Dice:


  924. claudia Dice:

    hola.me gusta mucho james

  925. claudia Dice:

    james es guapisimo

  926. mari paza Dice:

    james te amo cuantos años tienes eres el mas gupisiiiiiiiiiiiiiiiiiiiiiiiimo de big time rosh eres un papasssiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiito you love te ammmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo nunca mte olvidare mandales saludos a kendal,logan y carlos
    te amo nunca lo olvides

  927. mari paz Dice:

    cuando lo leas nunca lo olvides eres el mejor de big time rosh te amo james

  928. mari paz Dice:

    uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh los que dijeran que estas feo no es cierto eres un papasito y te comeria a besos you love I love james te aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaadoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooorrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrroooooooooooooooooooo james nunca lo olvides te amo

  929. mari paz Dice:

    love james

  930. mari paz Dice:

    love james

  931. fernanda Dice:


  932. muñeka solo re pte Dice:


  933. muñeka solo re pte Dice:


  934. Britany maslow Dice:

    Hello i am james his motrer is my sister plis dont violenc

  935. mariannys rodriguez Dice:

    yo lo amo mas q a mi vida daria todo x conocerlo o verlo aunq sea stoy enamoradisima d ese muchacho tengo miles d fotos d el y algunas canciones ah tambien veo BTR todos los dias T AMO JAMES MASLOW

  936. RUT Dice:


  937. RUT Dice:


  938. marce gutieres Dice:


  939. violeta ferreyra Dice:

    hay james te amoo! soy tu fan desde los 6 años te amo te quiero y no dejo de verte en big time rush ni dejo de verte en you tube voz, kendal, carlos y logan hacen buena banda los escucho todo el tiempo y les quiero pedir un favor agan un recital en el lugar que sea de argentina y los voy a ver se los prometo a y me gustaria conoserte en persona aunque seas ingles y yo argentina te amo adoro y quiero nunca dejare de verte ni amarte adios!

  940. elva alejandra de maslow Dice:


  941. elva alejandra de maslow Dice:


  942. elva alejandra de maslow Dice:


  943. Diana Dice:

    James Tee Ammoooo Tu Faan #1
    Super Sexy Guapo Y Atractivoo Tee Amooo
    Poor Diiosz James Maslow ILY Por Siempre

  944. paulina Dice:

    james te amo

  945. katia lizeth Dice:

    te amo james te adoro quisierra conocerte

  946. bff Dice:

    hay james te amoo! soy tu fan desde los 6 años te amo te quiero y no dejo de verte en big time rush ni dejo de verte en you tube voz, kendal, carlos y logan hacen buena banda los escucho todo el tiempo y les quiero pedir un favor agan un recital en el lugar que sea de argentina y los voy a ver se los prometo a y me gustaria conoserte en persona aunque seas ingles y yo argentina te amo adoro y quiero nunca dejare de verte ni amarte adios!james eres re lindo, me gusta como cantas y me gusta cuando tu pelo esta al viento en algunos video.me gustaria verte en persona y no por la tele, te digo que res el chico mas lindo que vi.me gustan los videos que hacen y mi hermana cuando escucha los videos canta muy contenta.
    james te adorooooooooooooooooooooo y te amooooooooooooooooo tengo todos tus posters bueno tengo mas fotos de vos solo y no de los cuatro.

  947. bff Dice:

    por fabor ser mi novio soy muy bella como tu nos casaremos en la inglesia y tentremos hijo uno se llama james y otro se llama jamesy

  948. evely Dice:

    jame ere lo maximooooooooooooooooooo

  949. karina Dice:

    me encantaa james es tan lindo y tenemos tantas coasa en comun empezando por el signo jejeje


    OLA james mi ermana menor te ama y creo k tienen algo en komun le gusta practicar futbool y ella tambien tiene una cikatris pero en la muñeka intentando saltar esk a ella le toko un personaje de una abra de teatro k tenia k saltar de una mesa y se corto kon el baso de mesa responde porfabor siii

  951. claudia Dice:

    james maslow es un bombon guapppisssimo.me encanta es monisimo

  952. claudia Dice:

    me guastaria verle en carne y hueso es q es tan wuapoooo
    es un peluche

  953. neirimar Dice:

    te amo james wooh eres lo maximo y eres super lindo te amo y espero conocerte algul dia te amo Dios te bendiga y te cubra siempre con su sangre presiozza te amo bendiciones para tu vida

  954. neirimar Dice:

    te amo james wooh eres lo maximo y eres super lindo te amo y espero conocerte algul dia te amo Dios te bendiga y te cubra siempre con su sangre presiozza te amo bendiciones para tu vida…….<3

  955. neirimar Dice:

    quiero conocerte te amo
    eres super beeeeeeeeeeeeeeeeeellooooooooooooooooooooooo…….
    mejor dicho bellizziiimooooooooooooooo…..Te amooooooooooooooooooooooo <3 <3 <3<3<3<3<3<3 "big time rush" es lo mejor de nickelodeon tu,logan,carlos y kendyll son super lindos pero tu mas te amo jame i love god te bendicga siempre

  956. neirimar Dice:

    de verdad james david maslow es suuuuper lindo………te quiero bebe i love you
    te amo james te amo james te amo james te amo james te amo james te amo james te amo james i love james i love james i love james…….

  957. julia Dice:

    haaaaaaaaaaa!!!!!!pero k guapooooooo!!!!!!!!!!!!!!!!!me encanta le adoro es lo mejor!!!ademas en todas las escenas k ase sale bien!!!!!!!y todas las fotos son perfectas en mi ordenador tengo montones de fotos suyas!!!!!!!!le adoro es perfectoooo!!!!!!!!!!si a todas os gusta james yo he echo en tuenti una pagina web si kereis podeis entrar le e puesto: apuesto a k puedo encontrar a mas de 50.000 personas a las k les parezca wapo james maslow seguro k con vosotras son mas de 50.000 personas!!!!!!!!!!wapo james!!!

  958. Janis Morales Dice:

    Mentira porque el perro se llama Fox amerme

  959. julia Dice:

    james te adoroooo!!!!!como se k no hablas español lo traducire despues ero eres el mas guapo el k mejor cantaaaa el sueño de mi vida ojala dieras un concierto en andalucia san fernando cadiz te amo te adoro las compraria sin dudarlo tres veces porque eres la mejor persona del mundooo!!!!!ojala pudiera volver al dia en el que vi por primera vez big time rush fue el mejor dia de mi vidaaaa, ahora mismo estoy viendo tu serie es el capitulo en el que una presentadora empieza enseñando el lugar y dice: y donde se grabo su primer exito musical y salis bosotros por detras diciendo o o ooo ooooooo!!!!!

    james love you!! as k do not speak Spanish then translate what are the most handsome ber k cantaaaa best sleep of my life hopefully you gave a concert in san fernando cadiz andalucia I love you I adore you buy it without hesitation three times because you’re the best person in the mundooo!! wish I could go back to the day where I first saw big time rush was the best day of my vidaaaa, now I see your number is the chapter in which a presenter begins showing the place and say, and where he recorded his first hit musical and salis bosotros from behind saying ooooooo ooo oo!!

  960. YAHAIRA Dice:


  961. elva casanova Dice:

    james me pregunto si puedes hablar español

  962. neirimar Dice:

    buen dia james espero que este dia se a de bendicion para tu vida que el señor derrame bendiciones en ti y que aklgun dia le puedas servir como el lo desea te amo dios te bendiga………

  963. daniella Dice:

    oie woom qe ondaqe no entienden y no les cae en la cabezita qe tienen qe el JAMES DAVID MASLOW es MIIOO !!!!!!!!!

  964. anita Dice:

    wwwwoooowwwww james y yo tenemos un mundo en comun yo tambien soy cancer y soy de el 15 de julio un dia antes que su cumple cumplo yo,tambien me gusta el verde,me gusta el basquet y el futbol son los dos deportes que yo practico,y ademas esta guapisimo,mas guapo que mi novio llamado mauricio,ya quisiera que tu fueras mi BF,te amo james desde la primera vez que vi su programa en nickelodeon,espero que algun dia vengan a dar un concierto en mexico en el estado de tabasco,lloraria por verlos a todos cantar. TE AMO JAMES TE AMO CON TODO MI CORAZON.

  965. mariana Dice:

    tenemo0s casi to0do en comun menos en qke tu color favorito es el verde
    el mio0 es el azul hahahaha
    wooooo?? la neta es increible qke tengamos lo mismo en comun
    seria padre poder conocerte en persona y saber qke se siente estas a lado0
    de una persona muy importante para las chavas de to0das las edades
    pz en las series me gusta tus papeles qke te dan son divertido0s
    espero0 algun dia poderte conocer en en perso0na y qke veas qke soi distinta
    a todas tus fans hahahahah
    increible podria decir qke te AMO ahahahah
    ICH LIEBE DICH hahaha te amo en “aleman” :)
    me gusta muxo0 la serie de big time rush

  966. Liizeth Paaz Dice:

    James eres imprecionante me encantas eres el mejor te me reces mas de lo que ya eres te amo te deceo lo mejor eres super guapismo eres PERFECTO..!!!! Como Tu NO Hay nadien <3 <3 <3 :)

  967. Devany (rusher de corazon ;) Dice:

    estoy junto con todas las chicas que han comentado :) (exepto elizabeth 7.7) pues james no solo te amamos por tu fisico, si no, tambien por tus sentimientos y forma de ser ,tu , kendall scmidt (HeffronDrive), carls pena (thecarlospena), y logan henderson (loganhenderson1), son unicos en la vida para mi son alguien a seguir no les dire que los amo (aunque si lo hago xD) si no que ahora son parte de mi vida tienen mucha sabiduria por compartir y por saber cuando los conoci supe que eran personas de buen corazon se les nota (aunque las apariencas enga~an :/ pero no siempre :) nos han dado los momentos mas divertidos, dificiles , hermosos , de todo tipo de momentos pero vale la pena (carlos *–*)pues ( yo les digo angeles xD ) unos angeles tan especiales en este mundo valen la pena , amo su serie ,su banda ,todo ,lo que tenga relacionado con ustedes los que les quiero decir ya “directo” es: ” SON MIS IDOLOS ESPECIALES *–* Y GENIALES ,UNICOS ,DIVERTIDOS Y GENIALES!!! xD”
    P.D. yo creia que no existia la perfecion e.e

  968. milagros Dice:

    eres muy lindo pero carlos es guapisimo …..

  969. jesus belen cisneros leyva Dice:

    I love James Maslow

  970. claudia Dice:

    i love james maslow

  971. lucia Dice:

    p0r di0s stas wuapisim0 mi am0r!!! m3 3ncantaria kn0certe alwun dia me enknta cantar , bailar y actuar jeje sper0 c0n0certe pr0nt0 venwan a c0sta rika jiji=p

  972. paulina maslow Dice:

    te amo conthodo mi corazon con thoda mi alma con thodos mi huesos te amo

    te amo


  973. julexy amnabell Dice:

    el el 2 chico mas lindo del programa de bigt the rash y lo amo muuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuucccccccccccccccccccccccccccccccccccchhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhoooooooooooooooooooooosea yo

  974. luis Dice:

    Jemes me gustaría conocerte.Soy tu fan número uno y he escuchado todas tus canciones y además lo se todo sobre ti.Tenemos mucho en común mi color preferido es el verde, me gusta cantar, actuar…
    SUERTE JAMES¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡

  975. JaMes Max Dice:

    Y TENGO 18 AÑOS hahahahahaa……

  976. ana galilea rodriguez perez Dice:

    te amo james maslow eres mi sueño te amo james ire a tu consierto contestame siiiiiiiiiiiiiiiiii <3 :D

  977. jessica Dice:


  978. melissa Dice:

    hola kositha me encantas komo cantas eres el mas guapo de los cuatro ojala vineras a colombia te encatara este pais T AMO BB MI NOMBRE ES MELISSA UN KIS T CUIDAS

  979. melissa Dice:

    hi james I mean I love how you sing the best I love you to come to Colombia is hopefully a very nice country heard live in the capital Bogota I love you have a very pretty face

  980. grizzel Dice:

    hola james solo t digo q estas bien huapo qien t biera eres una ermosura y nada d lo q dicen esas p……….s es cierto tu eres mio y nadamas t amo y eres el amor de mi vida chikito i love forever m encanta tu programa mas cuando estas tuuu y saludam a kendall ,logan , y carlos y dile a logan q lo amo q esta bien huapo adios t amoooooooo

  981. Melanie valeria Dice:

    Por favor chicas pongan lo k pongan james ese guapo es solo mío por k yo lo amo mucho mucho (aunque les duela)

  982. Melanie valeria Dice:

    Perdón como te llames james ya esta dictado james es mío uuuuh

  983. laura elena cantu gonzalez Dice:


  984. cinthya garrufe Dice:

    te amo James maslow no sabes cuanto te kiero in July im go to stai in San Diego to go to chula vista to visit you

  985. celeste mendez Dice:

    james te quiero un monton<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3

  986. johana Dice:


    james te kiero konocer me kiero casar contigoooooooooooooooooooooooo

  987. paola anahi Dice:

    te amo james eres el mejor de big time rush y yo tanbien te kiero conocer eres lo maximo te amo james

  988. elines. Dice:

    Te amo james amo a toda la banda pero aty te amo mas porke eres el mas guapo, me sorprende la hermosa cara ke tienes lo ke mas deseo es conocerte e ir a un concierto tuyo y de toda la banda y tener una foto tuya con migo y mis hermanas, mis hermanas y yo te amamos y decimos ke eres el mas guapo del mundo y siempre en las noches le digo a mis hermanas ke sueñen con tigo y eyas me dicen lo mismo, soy tu fan numero 1 en nla vida, eres el amor de mi vida, y solo deseo verte algun dia y se ke si lo ago me desmayo porke esres lo maximo y eres el mas guapo del mundo, tu papel en Big Time Rush lo haces de maravilla solo deseo verte y kiero ke sepas ke te amo y 3espero ke leeas esto my love.

  989. jasmine Dice:

    mis 3 siglas favoritas JDMB y qn diga qe no es bello se las vera con toda sus fanz! te amo James’z

  990. vaniesa Dice:

    james I LOVE YOU SOY TU FAN num 1

    te amoooooooooo kiss mee james plis plis plis plis plis plis plis ……………..


  991. fernanda Dice:

    james te amooo cuantos años tieneee

  992. jessik Dice:

    hola james ! eres lo maximo el mejor cantant y actor, cuando veo la tele solament la veo para vert ati ME ENCANTAS !!!!! . Cuando veo BTR en nick el capitulo q mas me gusta es en donde cantan la cancion nothing even matters. ADIOS t seguire viendo en t.v.

  993. daniela Dice:

    james, kiero conocerte eres el mas guapo de btr bueno auque me gusta mas carlos pena y me sorprendi al ver ke tu segundo nombre es david y me encanta su programa y no sabe lo ke dice brenda bedolla ke nosotras somos unas decerebradas x no decir de otra manera bueno ya casi es navidad y mi regalo es verlos en persona bueno a y me encanta la cancion boyfriend y la de any kind of guy bueno bye

  994. Nena Henderson Dice:

    Si te amo James Maslow pero el unico detalle fue el nombre de su perrito no se llama flaco se llama FOX ……



  996. paulina maslow Dice:

    felicidades james mañana es thu cumple te amo espero q te la pacesz bien te amo <3 y como qiciera esthar a thu lado para festejar thu cumple con tigo y consentirte te amo <3

  997. lisi Dice:

    hola eres GUAPISIMO quisiera conocerte vivo en el salvador quisiera ser tu novia escribeme por favor estoy enloqueciendo por TI


  998. jenni Dice:

    james feliz cumpleaños que te la pases muy vien hoy

  999. jennifer Dice:

    I LOVE james yo soy tu fan te adoro me gusta como cantas tengo toda la mucica de BIG TIME RUHS me encanta las canciones del 2 albun

  1000. Nayeli Dice:


  1001. paulina maslow Dice:

    ¡FELICIDADES!!!!!!! James te amo bb eres lo mejor

  1002. paola maslow burge Dice:

    Hola mi james no sabes cuanto te amo y en serio quisiera conoserte en persona no tenemos tantas cosas en común pero yo no digo mentiras como las otras y espero que pronto vengan a morelia i love you my james

  1003. rusher forever Dice:

    yo amo a james maslow no solo es el mas guapo de BTR si no del mundo

  1004. NICOL Dice:


  1005. paola Dice:

    happy birday

  1006. annapau Dice:

    eres guapisimo y pues sueño con tigo todas las noches powrq t amo my color favorito bueno digamos q no tengo color favorito y enrealidad el verde no me gusta pero es el color favorito de mi hermano te escribi un comentario en facebook( mi foto es con un lazito rosa y ua calavera en el centro) vengan a ecuador te prometo q si vienen no faltare a su concierto muaak

  1007. jimena Dice:

    eres el mejor james yo estoy aciendo q mis amigas (grace diana linda ximena adriana michelle hannia casandraetc) vean mas tus videos =D te adoro!!!!!

  1008. annapau Dice:

    annapau am again and as you may not know spanish you will write the same as above only in english because i love you and i really want to understand what i write you´re very handsome i dream with you every nights because i love you my favorite color well i don´t have favorite color and i don´t like the green but is the favorite color of my brother i wrote a comment on my facebook my photo is a pink butterfly with a skull in the center ) come to ecuador if you come i promise you i will not miss to you´re concert muak please read this comment i can´t live without you =)

  1009. annapau Dice:

    aa and i thing that you´re more handsome that BRAD PITT REALLY

  1010. fernanda Dice:

    james esta guapo pero kendall es el mejor

  1011. ailema Dice:

    yo y james somos identicos

  1012. natalia Dice:

    te amo james solo qkkeee en algo qke se equibokaron fue en tu perro ahi dice que se llama flaco y es FOX te amo !!!! james y qkisiera conoserte awwww qke lindo eres!!

  1013. carolina Dice:

    son geniales cantan perfecto son los mejores del mundo los amoooo y especialmente me encanta james me encanta su sonrisa y su mirada tenemos mucho en comun

  1014. zakura Dice:

    james I’m another one of your fans so here add me on facebook clear site but I tell you when a question or do not come to juarez porfabor I ask you to and tell Kendall that I love him more and also to answer me oh well hopefully I naomi on facebook called maslow
      poneme sorry for your last name

                                                         zakura atte

  1015. zakura Dice:

    :) I <3

  1016. rocio Dice:

    james estas bien guapisimo y es solo mio

  1017. susan martinez Dice:

    TE AMO James tenemos mucho en comun ve a honduras porfe
    te amoooooooooooo muchooooooooooooooooo

  1018. litzy arely Dice:

    james eres un gran artista ojala i vengan atocar a cuernavaca i love james <3

  1019. Caro' d maslow Dice:

    James es Solo mioo de nadie mas es un completo sensualon! C: estas bien sexi <3

  1020. cielo Dice:

    james estas como quiere te amo

  1021. sil Dice:

    james maslow sos hermoso amo a foxy tu terrible cuerpaso que tenes estas muy bueno papeee

  1022. jade Dice:

    james eres genial y yo pienso que eres el que mejor canta del grupo y algun dia haber si se me cumple conocerte =D

  1023. alondra traaviezita monsivaos Dice:

    james you are the love of my life I love you my favorite color is green hope ke amm read my menzaje and not all above and also I have a perritho yho amm ilove waslow james

  1024. angie Dice:

    guau muy muy guapo quisiera conocerte pues te tengo agregado en mi faceboof me encanta thu musica es mi favorita todos los dias te veo en nikelodeon y se te nota q eres chevere no me lo bas a creer pero cuando leey thu historia dije guau su color favorito es igual al mio verde

  1025. melisa Dice:

    james te amo veni ala argentina micolor favorito es el verde i love te amo aca es la nueva pelea james maslow vs harry styile
    yo hablo english jaja

  1026. yasenki Dice:

    me encanta james por sus brazos , sus labios te amo y si me dijeran que dejara mi novio daniel lo aria

  1027. brenda Dice:

    i love james maslow every days 4-ever……………………… :D

  1028. carolina Dice:


  1029. carolina maslow Dice:

    hello friends solo quiero decirles what in serious love a james no pierdan su fe de que algun dia pueden y van a conocer a james solo pongan de su parte yo de verdad que amo a james con todas mis fuerzas y me imagino que ustedes tambien lo aman pero es en serio yo si lo amo con todo mi corazon y voy a ser todo lo posible para ir a verlo a lima soy de guayaquil y hasta peru boy a ir solo para verlo cantar ustedes hagan lo mismo si son de aqui de guayaquil las quiero rusher sigan con su mismos sueños no lo pierdan lo unico que digo es que james es solo mio bye

  1030. fernuuuuuuuuu Dice:

    jajjajajja chicas yo que ustedes ya iria dejando de lado a james porque ya tiene dueña ajajjaa hay chicas se pelean porun chico obio hermoso pero no se dan cunta de que no se va a fijar en ustedes porque ya tiene dueña chicas no se enojen conmigo por decir la verdad jajajjajaajja

  1031. cachita Dice:

    mira fernuuuuuuuu no estoy de acuerdo contigo por que no tienes ningun derecho de criticarnos asique porque no se lo preguntas a james nena???? da la caraaaaa

  1032. dulce Dice:

    chiks comprendo que les guste james pero no se peleen por el deben saber que el siempre tendra un lugar en su corazon para todas sus fans que son millones y millones, elizabhel no nos digas pendejas por amar a james por que si somos pendejas tu que eres?????? no quiero discutir con ustedes chicas pero tampoco quiero que se anden peleando por james a el no le gustara eso no quiero ser cruel pero ustedes se tienen que poner en el lugar de las otras chikas por que si tu lo amas ellas seguro que tambien, espero que comprendan mi mensaje las que puedan debajo de mi comentario opinen que les parece, millllllll graciasssssss!!!!!!!!!

  1033. Agustina Dice:

    Te amo, James, soy tu fan N 1, tengo tus fotos en mi telefono, en mi cuarto, en mi pc, en mi carpeta e incluso en mi ropa, me gusta cantar, me gusta actuar y ya se que ya tienes novia, pero solo soy una fan mas y ojala puedan venir a Catamarca, Argentina, porque aqui somos muchas las fans que tenemos la esperanza de que algun dia vengas tu con los demas chicos de Big time Rush porque los amamos y si alguna vez, tenemos la oportunidad de conocerlos, no la desaprovechariamos ya que seria un sueño hecho realidad y aunque yo, que tambien tengo muchos otros sueños, este es el principal que quiero hacerlo cumplir. Besos desde Catamarca, Agustina

  1034. martina Dice:

    es mio y solo mio tenemos muchisimo en comun o sea todo por ejemplo:
    el color verde
    a mi tambien me gustan los caballos y
    me gusta ese libro
    y lo conoci en argentina
    les gano a todas jajajajajaj es miooooo

  1035. martina Dice:

    y ecima vi a perro en persona y a el y les digo
    las no fans de james le dicen gay yo digo que las mato
    a todas este es el chisme de la banda btr y yo soi la numero uno
    en toda la banda por que tengo los albunes y los posters y de todo de todo lo demas y tengo todo lo de james no es que sea visiosa pero tengo en mi emepe tres todas las canciones te amo james y te quiero con todo el azmor que le puedo dar a un james de mas y esto no se lo dijero las demas jajajajaja y haora estoi escuchando
    city is ours es mi favorita y la suya no se copien y tambien me gusta carlos

  1036. angui paola Dice:

    tan hermoso que papasito qui ero darle un beso en la boca que lindo

  1037. angui paola Dice:

    temando mi telefono 2564018
    vivo en colombia

  1038. Xime Dice:

    Q les pasa james es el más feo del mundo es gay

  1039. clara Dice:

    ********(¨`•.•´¨).I.(¨`•.•´¨)* *********
    ****(`•.•´`•. ¸.•;Love`•.¸.•´`•.•´)*****
    *****`•.¸.•´*JAMES MASLOW*`•¸.´******
    *******`•.¸(¨`• Forever•´¨)..•´********
    **************`•.¸.•´********* ******

  1040. mariana Dice:

    ********(¨`•.•´¨).I.(¨`•.•´¨)* *********
    ****(`•.•´`•. ¸.•;Love`•.¸.•´`•.•´)*****
    *****`•.¸.•´*JAMES MASLOW*`•¸.´******
    *******`•.¸(¨`• Forever•´¨)..•´********
    **************`•.¸.•´********* ******

  1041. Ro pauvels Dice:

    Emmm, no tiene una mascota q se llama Falco, se llama Fox y es un perro!

    Es hermoso!

  1042. valentina andrea q. Dice:

    yo sipudiera cono serlo enserio loamo muxxxxxxxxxooooooooooo y tanbien loquiero muxoooooooo pero lomaluco es qyo vivo en colombia medellin sipudiera ablar conel afrente yo le yria loamo ylo quiero pero comoyosipudiero ri amexico o estados unidos poreso yo amiro a jemes por q canta hermoso y tanbien carlos peña , kendall schmidt y longan hardeson losamo atodos pero lomayor amor qtengo en mi corazon es james ymuchagracias por leer este mensaje y q importa qtenga 12o15 loq importa es el amor qtengo con james y ojala lesguste este mensaje y atodos les mando un beso atodos muuuuaaaaaaaaaaaaaa los amo……..

  1043. valentina andrea q. Dice:

    yo sipudiera cono serlo enserio loamo muxxxxxxxxxooooooooooo y tanbien loquiero muxoooooooo pero lomaluco es qyo vivo en colombia medellin sipudiera ablar conel afrente yo le yria loamo ylo quiero pero comoyosipudiero ri amexico o estados unidos poreso yo amiro a jemes por q canta hermoso y tanbien carlos peña , kendall schmidt y longan hardeson losamo atodos pero lomayor amor qtengo en mi corazon es james ymuchagracias por leer este mensaje y q importa qtenga 12o15 loq importa es el amor qtengo con james y ojala lesguste este mensaje y atodos les mando un beso atodos muuuuaaaaaaaaaaaaaa los amo ytanbien sus ojos son hermosos……

  1044. valentina andrea q. Dice:

    yo sipudiera cono serlo enserio loamo muxxxxxxxxxooooooooooo y tanbien loquiero muxoooooooo pero lomaluco es qyo vivo en colombia medellin sipudiera ablar conel afrente yo le yria loamo ylo quiero pero comoyosipudiero ri amexico o estados unidos poreso yo amiro a jemes por q canta hermoso y tanbien carlos peña , kendall schmidt y longan hardeson losamo atodos pero lomayor amor qtengo en mi corazon es james ymuchagracias por leer este mensaje y q importa qtenga 12o15 loq importa es el amor qtengo con james y ojala lesguste este mensaje y atodos les mando un beso atodos muuuuaaaaaaaaaaaaaa los amo ytanbien sus ojos son hermosos…… muaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

  1045. valentina andrea q. Dice:

    yo sipudiera cono serlo enserio loamo muxxxxxxxxxooooooooooo y tanbien loquiero muxoooooooo pero lomaluco es qyo vivo en colombia medellin sipudiera ablar conel afrente yo le yria loamo ylo quiero pero comoyosipudiero ri amexico o estados unidos poreso yo amiro a jemes por q canta hermoso y tanbien carlos peña , kendall schmidt y longan hardeson losamo atodos pero lomayor amor qtengo en mi corazon es james ymuchagracias por leer este mensaje y q importa qtenga 12o15 loq importa es el amor qtengo con james y ojala lesguste este mensaje y atodos les mando un beso atodos muuuuaaaaaaaaaaaaaa los amo ytanbien sus ojos son hermosos…… muaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa loveme you

  1046. oriana(fans de btr) Dice:

    yo la vi a la cicatriz en un episodio cdo gastan mucha plata y gustavo les dice q busqen ampleo y james busca modelo y keyti le da modelo de codos y cdo el se sta llendo lo habla el espejo y el dice”si es lindo y suabesito” jajaja y muestra el codo y selo ve men encanda :)

  1047. CAMILA Dice:

    do tee amoo amoor of mii vidaa sos you amoo and the amooo to loga, carloykendall desearie be the nobia of james maslow to tengoo 20 and is enseriooo je us him mientooo je muchoo amooooo? (=) < 3!

  1048. CAMILA Dice:

    (te amooo sos my idols know tell them a secret only mioo mioo je my first kiss was in the colegioo yooo I love them but are not with migoo told him to look for a hernades miryan videos and that you is for yames maslow is: man I amooo searching them for you tuben jee the amooo much =) < 3

  1049. CAMILA Dice:

    ********(¨`•.•´¨).I.(¨`•.•´¨)* *********
    ****(`•.•´`•. ¸.•;Love`•.¸.•´`•.•´)*****
    *****`•.¸.•´*JAMES MASLOW*`•¸.´******
    *******`•.¸(¨`• Forever•´¨)..•´********
    **************`•.¸.•´********* ******

  1050. dede Dice:

    ola james solokierodecir k kiero konocerte

  1051. dede Dice:

    ola james solo kiero decir k kisiera konocerte eres super

  1052. vale Dice:

    te amo james eres tan genial y tan lindo a mi igual me gusta el surf balonsesto beisbol y futbol yo canto,bailo y soy muy buena actris

  1053. NICOL Dice:


  1054. ketering Dice:

    ojala lo vea de nuevo es hermoso mi alma gemela nos gustan las mismas cosas
    todo todo lo vi en estados unidos y le hableeeeeeeeee dijo que soi linda
    y me dijo i love te amo me dijo susurrando no estaban logan ni kendall
    y carlos estaba tambien le able pero kendall estaba en su casa yo me fui a la casa
    no le molesta a nadie no estaba la novia y el perro me lamio estaba en la playa

  1055. ketering Dice:

    a me dijo logan que soi lindisima o sea gusta de mi o que se yo voi a estados unidos
    y le pedi el celu de el james aaaaaaaa el viernes vuelvo a estados unidos
    y lo voi a ir a visitar se como es la casa y todo y me prometio ir a nueva york

  1056. ketering Dice:

    ey la que dice que es mentira se aprovecha de charlar con el ja porque ustedes
    no lo ven en persona yo si
    pero felicitaciones se ganan un viaje comigo porque dijo que puedo llevar una amiga
    pero si llego a ser la novia no me digan que es mentira
    porque justito hoy me voi para alla :p

  1057. jaritax Dice:

    te amo presiosoooo amooo amooo wapoo aahhhh no se como explicarlo lindoooooooooooooooooooooooooooooooooooooooooo <3 <3 <3 <3

  1058. dulce Dice:

    chicas respondan mi comentario por favor!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  1059. Catalina Dice:

    James Maslow eres dmc lindo ”TE AMO”, me muero por conocerte!

  1060. vale Dice:


  1061. vale Dice:

    james te amo mucho eres el mas lindo de toda la banda sin ofender a los demas,te amo mucho,eres tan tierno me encanta como cantas tu y todos los otros lo malo es que no voy a poder ir al concierto de BIG TIME RUSH que fome bueno me despido A SI ELEZABET YO NO SOY PENDEJA QUE TE PASA YA

  1062. daniela Dice:

    Yo amO a James Maslow ! A el y a sus amigos de la banda Big Time Rush! <3

  1063. Annie Garay Dice:

    how msuper bien me parese genial que hayan escrito sobre James Gracias y te amo JAMES MASLOW

  1064. Ari Dice:

    Amo a James pero yo no me fijo en el exterior es un buen chico y por eso lo quiero

  1065. naoomisiitha Dice:

    I♥♥ LOVE♥♥ JAMES
    X FIS

  1066. mariana Dice:



  1067. linibeth Dice:

    te amo jamessss espero que algun dia venga a republica dominicana para ir a verlos !!!! vengan prontoo

  1068. Lizeth G. Dice:

    El perro de James se llama FOX no FALCO!!

  1069. mical Dice:

    te super amo james maslow

  1070. mical Dice:

    espero q algun dia nos conoscamos

  1071. roxy Dice:

    amy no me importa lo q digan las demas todas nos peleamos por un muchacho y vale no escribas mucho love james con una sola palabra te entendemos ok y claro q me gusta james

  1072. dany Dice:

    james te amo demaciado soy rusher de corazon

  1073. nubia lizeth Dice:

    mierda su pérro no se llama FALCON de se llama FOX animes nches rseras que pusieron esto son una mierda todo esta mal hijas de PT

  1074. alexandra Dice:

    james eres jenial y quisiera conoserte en persona

  1075. karime Dice:

    hola kendall soy karime te amo y quiero cono serte en persona se que te gusta el color verde y que te gusta la boa piton espero que algun dia vengas a tabasco y que me cantes una cancion

  1076. karime Dice:

    oye quendall te quiero mucho mas que todas las chicas que te quieren y porfavor contestame

  1077. daniela Dice:

    yo amo james maslow lo adoro es la luz de mi vida el que me ilumina mi sendero te amo te adoro eres lo mejor lo maximo ojala me parecieras en mi casa te kiero
    <3 <3 <3 <3 <3 <3 <3 <3 <3 soy de panama y espero que vengan a dar un concierto en el 2013

  1078. daniela Dice:

    la vddd completamentee lo amoo es el mejor de tds es una gran personaaa no lo puedoo creer seria la vdd seria lo mejor si llegara a conocerlooo
    “james” TtEe AaMmOo eres lo mejor de lo mejorr ♥♥♥♥♥♥

  1079. la chica de james Dice:

    Hola James si lees este mensaje dire que quiero ser tu novia te quiero besar y que eres guapisimo me gustaria mandarte una foto mia para que veas que soy linda pues estoy trabajando de modelo ahora pues aunque no lo creas soy tu fan numero 1 y te amo papasito pues eres super guuuuuuuuuuuuuapo :) ojala vengas algun dia a el salvador te amo adios .

  1080. julia Dice:

    para “katering” una cosa wapa k seppas k james nacio en nueva york pero no vive alli!! yo si se donde vive y eres una falsa por k ablan muy poco español!!!por tanto no creo k pudieran desirte tanto a no ser k sepas tanto ibles u americano como para entender todo lo k te decian y lo rapido k te lo decian di esk te lo an dixo,yo en cambio si se donde viven y demas, y no digas k te vas a combbertir en su novia por que ya tiene y se llama halston sage asi k kallate y no mientas a las demas H.P entendido?? por k lo unico k ases con tus mentiras es rayar a la gente!!

  1081. katering Dice:

    hace un mes que salimos y me dio un beso yo no tengo la culpa en la bocaaaa
    dios besa para el santo dios genial lo amooooooooo asta deja su vida por mi
    en estados unidos es todo pocible solo no se si romper con el o no lo decido yo no ustedes

  1082. micaela Dice:

    hay es super mega ultra guapo , tenemos todo en comun soy rusher a muerte y si iria a ee uu es para conocerte
    :) te amooooooooooooooooooooooooooooooooooooooooooooooo!!!! :D

  1083. micaela Dice:

    pues katering no tiene razon yo soy la novia

  1084. ARIANA Dice:


  1085. lucero martinez escobar Dice:


  1086. Fabiana Maslow Dice:


  1087. stephanie pena de henderson Dice:

    su perrito no se llama asi, se llama fox

  1088. Fabiana Maslow Dice:

    a mi tambien me encantra el verde TE AMOO JAMES DAVID MASLOW BURGUER <3 :*

  1089. claudia rios Dice:

    james maslow soy thu mayor fans del mundo entero eres el unico que me has impirado y te digo que mi unicor verdadero amor eres thu y no te voy a tejar nunca

  1090. claudia rios Dice:

    james maslow much I love you and I will never ever let you know that I love you much

  1091. claudia rios Dice:

    i love james maslow
    ilove james maslow
    i love james maslow
    i love james maslow para siempre

  1092. claudia rios Dice:

    iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii lllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooovvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvveeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeesssssssssssssssssssssssssssssssssssssssssssssssss

  1093. meli acosta Dice:

    we love btr and i am rushers and maslower


  1094. brithany moposita Dice:

    james maslow’re so handsome than anyone that I love you
    I like you as you sing and as we have nothing heres common only want you ‘???

  1095. Valeria-1029@hotmail.es Dice:

    Teamoooo teamooo malditas nadien meqita james por qe es mioo soloo mio zorras teqiero james eres todo para mii<3

  1096. chiara Dice:

    cheecheche james es mioo escucharon es el mas lindo de la bandaa diosssss es hermoso asique miooo lo lamentoooooo loras les aviso y avos valentina 1029 o como sea es mio solo mio mio solo mioo siiii lee lo amo mas que autedesssss

  1097. chiara Dice:


  1098. joselin Dice:

    me quedo sin palabras te amo estas guapisimo

  1099. karen Dice:

    una berdadera ruser sabe que lo importante es que todas las ruser nos levemos bien

  1100. cindy Dice:

    enberdad no conocia muy bien a james pero ya me di cuenta que es una persona muy linda I LOVE YOU JAMES

  1101. Nashla Dice:

    James te pido que seamos amigos I LOVE YOU JAMES te amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo eres guapisimo y muy atractivo

  1102. Nashla Dice:

    mi color favorito es el verde igual

  1103. andi pintos Dice:



    james te amo enserio te quiero decir q vivo en barranquilla por q nunca vienen aqui de gira a cantar

  1105. joa maslow Dice:

    tenemos muchas cosas en comun casemonos

  1106. adriana salas Dice:

    saben niñas tontas ustedes se llenan la boca hablando de james y paran llenando la boca diciendo k ustedes tiene cosas en comun con james cuando es mentira y les apuesto k nicikiera an ido a un concierto de big time rush encambio yo si cuando llego aca a peru y dan asco escribiendo todas esas cosas pobres de ustedes dan asco y pena niñas hya ni se k decirles xk gente cm ustedes nno hay palabras cm expresarse taradas ademas james jamas se fijaria en ustedes encambio si me mira a mi eso esta mas k claro niñas puercas oing oing pendejitas

    A y para james solo te kiero decir k eres lindo y hermoso eres el mejor d big time rush te amo y eres super guapo eres el chico mas guapo del mundo te amo james

  1107. belu Dice:

    hola quiero decir que james maslow es el mejor chivo del mundo el mejor de la banda es lo + de lo+ me gusta todo de el quiero decir tambien que antesme gustaba logan per me di cuenta que me gusta james lo amo me gusta su voz .todo es muy guapo lo amo de verdad ojala vengan a tucuman alguna vez asi pueda ir a verlos aqui en argentina personalmente a james te amo soy tu fan numero 1 soy una rusher
    te amo james maslow!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! love me love me

  1108. Lorenita Dice:

    Hermosoote…!! Cáncer como yoo ..oh yeah :D

  1109. Lulii Dice:

    Aki me huele a rusherass!! —> adriana salas”” ke te sucedee por favoor, xke hablas asi ke no tienes cerebroo o ke? la neta eres mega rusheraa!!!,,,esta bien ke hayas ido a su concierto al igual ke yo lo hice aki en mejico pero no lo ando presumiendo ni insultando a mis herman@s rushers, osea ten algo de ceerebro,,, NO VUELVAS A INSULTARNOS ASI YA ,, SINO ARDERA TROYA okyaa,,,pero somos una familia y no tienes ke expresarte asi por dios, pero me keda claro, ke rusheras nos invaden wei,,,everywhere y lo digo x ti

    BTR es lo mejor del planeta …!! rushers y rusherboys 4ever…unid@ss

  1110. adriana salas Dice:

    sabes a mi k xk si yo tengo cerebro xk no soy una tarada igual k tu k esta diciendo k k x aqui k x alla sabes y no me insultes ya k te qde claro x tu eres una cm lo dicen en tu pais eres una naca si

  1111. karla lizbeth Dice:

    love james

  1112. Jheysel de Maslow Dice:

    bueno a mi me gusta mucho james esta muy guapo & me encanta muchooo
    quiesiera conocerlo te amo Jamesss!!!!! ♥ ♥ ♥

  1113. maria Dice:

    sabes te amo te amo tu eres la razon de mi vida queiero verte y conocertw vos para mi eres el mas lindo de big time rush te amoooooooooooooooooooooooooooo

  1114. maria Dice:

    i <3 james soy tu mas grande admiradora te amo

  1115. maria Dice:

    y eres demaciado lindo y guapo te amooooooooooo
    eres mi idolo mi hermosote belloo eres mi comotodo te amo mi vida

  1116. MARISA Dice:


  1117. Teresita Maslow!! Dice:

    james estas guapisimo,estas hecho un cuerazo, te amo…. todas las rusher son las mejores del mundo!!! con tan solo oir tu voz, tu nombre o tus canciones me derrito x ti mi amorrrrrrrrr!!!!! daria mi vida x ti cielo hermoso, ojala vengas a mexico!!!!! con tan soo oir “big time rush” pienso en ti, lloro x ti, grito donde sea que vea tus fotos ay es que estas superhipermegaarchirecontra SEXY,GUAPISISISISISISISISISISMO!!! ME DA GANAS DE BESARTE CUIDA TU BELLO ROSTRO GUAPO!!

  1118. vanessa tellez Dice:

    te amo james eres mas juapo ke kendall

  1119. anira alvarado Dice:

    I love james maslow

  1120. genesis Dice:

    waooo q ermosura de chico te amo

  1121. caro Dice:

    james eres lo mas bello khe ha esistido en este mundo vale te kiero mucho

  1122. joselin maslow Dice:

    hola james heres hermoso y gupo algundia te conosere eres el aRtista maS guApo de todos eres increible y chistoso te A M O y kisiera k me conte3staras porfas porfas james heres una hermosura yy me gusta mucho komo actuas

  1123. mariana Dice:

    yo no tengo tantas cosas en comun pero si me gusta el balonsesto y un poco el futbol y el color verde tambien un poco me gosta mucho como canta como actua y me gustaria mucho conocerlo perocreo que eso nunca va a pasar ero de todas formas no voy a cambiar de como soy aparte de que nunca va a pasar algo yo quiero ser como soy y nunca voy a cambiar

  1124. luisa Dice:

    los amoo big time rush sobretodo a James y logann esperoo qe un diaa venga a mexico (tijuana baja california) los amoooooo ♥

  1125. paula isabel Dice:

    te amooo soy tu fan numeroooo1

  1126. nathaly steisy santos cordero Dice:

    q tonta son las chicas aunk yo soy una de ellas pero soy embra y no soy tan tonta como para benir com ese cuentico dik de k todas le gustan tu color y k tienen cosas en comumespero k bengan a dar un concierto en republica dominicana k aigan pases a camerino a dios james tekiero ben

  1127. aylin Dice:

    que bueno que tengamos cosas en comun y mi signo tambien es cancer

  1128. ana lucia Dice:

    james meinvito selebrarout for my birthday

  1129. fany Dice:

    te amo JAMES eres el mas guapo de big time rush yo si te amo se muchas cosas sobre ti tenemos cosas en comun te amo eres el mejor de todos los chavos de este mmundo y no me importa si a mis amigas les gusta mas logan o carlos o kendall aun asi yo te amo eres el chavo numero 1 en mi corazon ocupas el 100% de mi corazon

  1130. Ana Dice:

    te AMO BASTANTE JAMES eres el chavo mas guapo de BIG TIME RUSH ………

  1131. janes Dice:

    Ama mira james es mi novio y tengo su face y tengo sus fotos tooooooooooooodas y donde esta queriendo dar un besoooooooooooooooooooooooooooooooooooooooooote

  1132. janes Dice:

    Q dises

  1133. James y su atractiva novia Dice:

    [...] entre las fans de la banda de “Big Time Rush“, es el guapo integrante James Maslow; quien recientemente se vio de lo más contento y feliz al lado de su [...]

  1134. paola Dice:

    hi james know you have many fans but many are your number one fans but you just will not belong to the person unaa tell you I love you in a chat or you are in the program btr but one that loves you and you true loves are very handsome and beautiful’m in love with you only think of you only in my heart these you just tell you that I love you I love you and adore you’re the most beautiful in the world my biggest dream is to meet you but never happen because we are very away I just want you to know and love and jealous men tell you something bad about you, you are not true what they say your fans and more I love you and always will meet you kisses and I’m dying to talk to you I love you james

  1135. paula Dice:

    ********(¨`•.•´¨).I.(¨`•.•´¨)* *********
    ****(`•.•´`•. ¸.•;Love`•.¸.•´`•.•´)*****
    *****`•.¸.•´*JAMES MASLOW*`•¸.´******
    *******`•.¸(¨`• Forever•´¨)..•´********
    **************`•.¸.•´********* ******

  1136. sandy Dice:

    mmm james eres unico te queremos caximb0 te <3 nicaragua

  1137. Isabella Dice:

    Si es lindisimo pero los,mas lindos son harry stiles,liam,zain,logan h y james

  1138. andrea joselyn Dice:

    mi ern yo soy canpatible con james y soy aser su esposa para yo soy sus novia mocosas loca tengo 22 años y soy modalo demexico
    te amo james att: joselyn

  1139. jocelyn Dice:

    los amo soy rushers de corazon <3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3<3

  1140. amdrea Dice:

    i love you james

  1141. andrea Dice:

    ¡¡¡ i love you james!!!!!!!

  1142. andreita Dice:

    me gustaria conoserte a qui en Colombia (Cartagena) soy muy tierna bueno creo que tu eres muy especial todas mis amigas son directioner pero me guta tu perrito amo mucho esa raza de perro lobo siveriano me siento muy feliz de ser rusher me gustaria que vinieras a ca a esta tierra calientica pero hermoza te deseo lo mejor en e l mundo james te deseamos saludos desde Colombia :)

  1143. andreita Dice:

    TQM JAMES ;) <3

  1144. karla isabel Dice:

    james maslow ez mi adorazion lo amo muxo komo kiziera konocerlo e ir a unoz de zuz konciertos tengo todo mi kuarto lleno de imagenez de jamez LOZ AMO MUXO ezta guapizizizizimo lo adoro

  1145. alejaa Te Amo James Maslow Dice:

    i love yo James Maslow Kuando Estoy Triste Pienso En Ti Y sE Me Kitan Mis Tristesas te amp te amo te amo te amo te amo

  1146. Nayi Maslow Dice:

    Hola, me gustaría muchísimo conocerte de veras ,soy de España como ves por mi acento. Me encanta el Verde es el color de mis ojos. Y me encantan los caballos, tengo 2 perritas muy cucas. Siempre que puedo veo Big Time Rush. Yo soy una Big Time Rushera JiJiJi. Bueno a lo que voy que me encantas es lo único que puedo decir enseriio :) Te quiero y me encantará conocerte. I <3 You , vivo en Madrid. Y me gustaría mucho ir a Nueva York deseo tanto ir a ese sitio tiene que ser maravilloso. Te Quiero. Todo el mundo dice que eres lindo y es la PURA realidad. <3<3<3<3<3<3 Si vienes a Madrid te aseguro que te encantará. Si te veo me tiro de la ventana enseriio estoy obsesionada contigo. Oye una pregunta ¿El grupo de Big Time Rush sigue junto o esta disuelto? Bueno espero que este junto todos cantais muy bien sobre todo tu James Maslow. <3<3<3<3<3<3, besos, Nayi Maslow. :):)

  1147. yara tinta Dice:

    james eres hermoso como no amarte eres el mas perfecto de btr cantantas super bien te amo

  1148. regina puente Dice:

    para mi y dijo que todas las demas estan equivocadas cuando lo conosi me enamore y aunque sea solo una cosa la q tengamos en comun para mi va a hacer una persona que ocupa parte de mi corazon no me interesa que no lo conosca que claro!!! ese siempre a sido mi sueño pero yo lo amo y no lo dijo como las otras yo si lo amo como si deberas lo conosiera que el es solo mio se mas cosa de el de lo que se imaginas y james ¡¡ TE AMO!! pero no solo dire eso deberas robaste parte de mi corazon espero algun dia conocerte

  1149. jackeline valencia cordoba Dice:


  1150. brisa Dice:

    hola james yo me llamo brisa y tengo 7 años y sos lindo

  1151. brisa Dice:

    hola james como te va yo me llamo brisa te amo

  1152. brisa Dice:

    james yo vivo en argentina y yo vivo en cangallo y varselo

    y te amo mucho veni a visitarme miau

  1153. brisa Dice:

    james como es tu contraseña para entrar a tu pagina wed
    sos muy lindo

  1154. brisa Dice:

    holaaaa sos lindo

  1155. brisa Dice:

    hola como estas yo te amo y sos lindo todos ustedes son lindos

  1156. brisa Dice:

    hola como te va

  1157. brisa Dice:

    agan un resital en argentina y que lo agan en avellaneda

  1158. brisa Dice:

    hola james como va yo soy tu fam numero 1
    eres el mas lindo

  1159. Alba Dice:

    ¡¡¡¡¡¡¡¡¡Ojala te conociera!!!!!!!!!!!!!!!!¿Sabes? Mi amiga Claudia y yo siempre estamos jugando a lo mismo, Big Time Rush, yo siempre me elijo a ti, James ¡ y hasta estamos haciendo una revista en honor a vosotros! Yo me encargo de sacar fotos e información de ti y de Logan, y mi amiga Claudia de Kendall ( que es el que le gusta) y Carlos. Seguro que nadie de las que te han escrito harán lo mismo que tu (actuar) ¡pues yo sí! Es más, llevo 6 años haciendo teatro ¡y si te dijera las obras que he hecho! Encima también canto, voy a coro y estepto el primer año de teatro en los demás he sido la única que en todo mi curso que iba a teatro!!!!!!!! He hecho un montón de obras de teatro ¿quieres que diga el número? Vale: 10 ¡y estoy con otra en manos! Te amo James!!!!!!!! Y sé que tipo de chicas te gustan: adaptadas a su agenda, ¡ y yo soy una de esas! ¡¡¡¡Somos el uno para el otro!!!!! A, y también bailo TQM!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  1160. ariadna Dice:

    calmense james es mio y megus ta el verde asi q nose metancon nel por q a i de ustedes bien ponganse a busadas mmm.

  1161. sebastian Dice:

    wau james te admiro quiero ser como tu, eres muy talentoso que viva btr que hay para rato……….

  1162. Priscila Dice:

    WEEEE:$ que paso aca? ya es mio es mi novio jaja NA:$ ya quisiera es mi platónico (de quien no) lo amo con mi ser lo es todo para mi es un divino su cuerpo su cara su personalidad tu voz todo todo es un ANGEL LO amo con mi alma♥

  1163. anonimo Dice:

    yo le kiero maaaaaassssss!!!!!1

  1164. anonimo Dice:

    esssss mmmio0<3<3<3tkm

  1165. brisa Dice:

    hola como te va e a mi mi color favorito es el verde y mi color favorito es el maron

  1166. Karlis Dice:

    Adoro a Big Time Rush es mi banda favorita, amo a James y es miiio <3 jejeje y k le siga llendo bien en su carrera besos moooak :*

  1167. brisa Dice:

    hola james como te va a mi me gute lo que te guste vos

  1168. sarahi salas jimenez Dice:

    james eres de lo mas guapos de big time rush saludame a tus compañeros bay te adoro ati y atu banda

  1169. Kassandra Garcia Martin Garcia Lapresa Dice:


  1170. Kassandra Garcia Martin Garcia Lapresa Dice:


  1171. Kassandra Garcia Martin Garcia Lapresa Dice:


  1172. alejandrita Dice:

    james es guapo y hermoso y es muy simpatico vdd

  1173. JM Dice:

    My beautiful friend James although I do love him angry!!!

  1174. brisa Dice:

    hola como te va ta amo eres el mas mas mas mas guapo que vi en mi vida cuando te vi me enamore de vos james te mo que te valla muy mu muy bien bien bien

  1175. brisa Dice:

    tengo un hermano bebe es un nene y tiene 1 año pero sige asiendo bebe sos hemoso james

  1176. estefania rivas Dice:

    hola JAMES miprima Carla ve tu programa todos los dias y se siente tu fan NO1 yo no te puedo ver todos dias pero cuando voi dond ella te veo y me paresces lindo siege haciendo lo q aces xfas responde mi pregunta WHAT IS YOUR HOBBY? te preguntaras xq te escriba asi es xq est s para un deber d ingles chao

  1177. laura Dice:

    me gusta como cantas y 3 de mis amigas son rushers y yo tanbien y te amo mi mejor amiga esta cumpliendo años hoy 29 de marso


  1178. Sthefhani Malow♥ Dice:


  1179. la fan n1 de big time rush Dice:

    bueno,mi favorito es logan pero voz sos el segundo de mis favoritos,el tercero es kendall y el cuarto es carlos,yo soy la mas grande fan de btr y tengo un libro que es todo sobre big time rush y ya complete solo el de logan y ahora que visite esta pagina ya complete todo sobre james y si me buscan ahora voy a ir al pop joven de kendall y despues al de carlos.yo fui al concierto.no lo olviden rushers como yo¡¡¡LAS QUE NO AMAN A BIG TIME RUSH NO SON NADIE Y LAS QUE LOS AMAN SON MUY COOLS¡¡¡ ¡¡¡LOS AMO BTR Y SIEMPRE LO VOY A HASER¡¡¡ chau rushers besos

  1180. cristina Dice:

    james eres muy lindo tu sonrisa esta hermosa y tu mirada es impactante en berdad eres muy hermoso como kisiera conocerte me desmayo tu eres tan lindo de tu cara estan hermosa tu eres como un osito de peluche muy lindo y tierno me despido adios james bye

  1181. FERNANDA Dice:


  1182. FERNANDA Dice:


  1183. maria Dice:

    james yo no solo te quiero porque eres guapisimo también porque cantas fenomenal

    porfavor si les este comentario contestame porfavor

    y dile también a tus amigos de big time rush que también son muy buenos.

    un besazo tu mayor fan.

  1184. María Fernanda Dice:


  1185. María Fernanda Dice:

    posdata 2: esto es para ti <3 <3 <3

  1186. lina villamizar Dice:


  1187. berenice Dice:

    yo no voy a decir k tengo cosas en comun lo uniko k yo se es lo maravilloso k eres y por ty resia casi capas de todo me encanta la musica de btr es lo mas maravillosa k e escushad en la vida btr es la resie mas maravillosa en la vida ojala y nunk se vaya de la television y este de por vida tambien k el grupio prmansca unido por sienpre me gustari muchooooooooooo conocerte james y eres lo mejor me fasinas i lo ve BTR and JAMES

  1188. kathy Dice:

    vivo en republica dominicana y me encantaria que big tim e rush volviera pero que diera su concierto en san pedro de macoris o en la capital para poder ir seria un sueño hecho realidad i iiii love b ig time rushhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

  1189. valentina Malik Styles Dice:


  1190. aury danahi aguilar loeza Dice:

    james eres wuapisimo,mayoria de mis amigas te aman, tienes un cabello perfecto, plisss buscame en el face…..<3

  1191. Valentina De Malik Styles Tomlinson Payne Horan Dice:

    Tngo una propuesta para rushers (las ke son d corazon) pues me imagino ke sabn ke soy directioner pro en nombre d las verdadras directioner les pido tregua xke no keremos ni cguir pleando ni dcpsionar a nuestros idolos en nuestro kso One Direction y en el suyo btr.
    Pro tambien kiero pdirles ke nos unamos contra the wanted ke como en muchos comentarios digo son una bola d encreidos,feos,sin talento y con aire en la kbza c creen la gran cosa qando no tienen ni la kinta part d talento d One Direction ni d btr


  1192. susi Dice:

    james estas super mega guapo te amo eres un bonbon y siempre sueño con tigo mi hermoso


  1193. danae Dice:

    anna estas muy equibocada por q james es mio y yo me voy a casar con el james tenemos muxas cosas en comun por ejemplo:
    mi color favorito es el verde.
    me gusta la musica.
    me gusta actuar.
    me gusta los caballos.
    ********(¨`•.•´¨).I.(¨`•.•´¨)* *********
    ****(`•.•´`•. ¸.•;Love`•.¸.•´`•.•´)*****
    *****`•.¸.•´*JAMES MASLOW*`•¸.´******
    *******`•.¸(¨`• Forever•´¨)..•´********
    **************`•.¸.•´********* ******

  1194. danae Dice:

    haaaaaaaa bengan a chile en la plaza de renca porfavor

  1195. karen Dice:

    estas guappppo y cumples un dia despues de mi cumple tenemos cosas en comun

  1196. Blanca Morales Dice:


  1197. Caro Dice:

    James te amo muuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuucho y estás bien guapo cada vez que ti veo en big time rush tengo ganas de desmayarme

  1198. Caro Dice:

    Acabo de enterarme que ya tienes novia, como pudiste?

  1199. Caro Dice:

    Acabo de enterarme que ya tienes novia, como pudiste?

  1200. paloma Dice:

    su perro se llama fox no faico y su color favorito no es verde

  1201. monsiii Dice:

    jemes maslow te amo soy una rusher de corazon te amo y a kendall a logany a carlos

  1202. samantha yamileth quiroz fonseca Dice:

    james te amo soy rusher de corazon los amo alos 4 pero sobretodo te amo ati eres tan sexi y sensual que me desago de verte aunque nadamas te vea en las fotos gravatelo bien te amo te amo te amo james <3

  1203. mariiana Dice:

    james y yo tenemos demasiadas cosas en comun soy cancer mi novio juega futbol y beisbol y me encantan los caballos y el color verde

  1204. mariiana Dice:

    lo unico q me cae mal james es q tiene una novia orible pero el es espectacular cuando empece a ver big time rush me enamore fue de james maslow y kendall es un poco bonito pero no le gana a james nunca i love james forever y amo a tu mascota fox :)

  1205. montse Dice:

    te amo james eres un bombon nunca me pierdo ningun capitulo de big time rush ojala y viniera a el distrito federal lo amo

  1206. gene llerena de Big Time Rush Dice:

    hi james ILOVE tu eres el mejor soy tu fans # 1 se todo sobre ti eres el mejor y big time rush is the best band in the world I was more or less speak English but I’m learning until the day you big time rush come to Ecuador please guys give a concert in Ecuador have many fans here who want q come but I want to come but please guys if you kiss the I love you all. ese es un poco de mi english bye

  1207. yemek Dice:

    Pfffffffffffffffffffffffffffff uds creen que James David Maslow va a ir a México o a Tucuman jajajajajajaja me dan pena xD

  1208. Valentina De Malik Styles Tomlinson Payne Horan Vas Hapennin Dice:

    Yo creo ke nada es imposible pro tratandoc d esos fanfarrones…pues no c hagan ilusiones pro sonar no qesta nada chiks yo tambn lo hago.

  1209. mariiana Dice:

    bueno yo amo a james cn todo mi corazon el es mi idolo el es unico en el mundo y james es mas lindo q mi novio pero se parecen xq mi novio juega todos los deportes q a el le gustan execto el surf I LOVE JAMES MASLOW FOREVER

  1210. alexandra Dice:

    jamaes maslo soy la mejor rusher te amo james maslo. carlos pena kendall , logan….siiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiii iiii iiiii iiiii iiiii iii soy rusher de corazon…………………….nadie me gana……..

  1211. fatimaslow Dice:

    yo amo a james maslow lo quieo mucho aunque yo se que aunque no nos conozca sabe que estamos para el el es la persona , mas bonita de el mundo por eso lo quiero TE AMO JAMES

  1212. fatimaslow Dice:


  1213. dulce Dice:

    pendejas de mierda que estupidas que son al pensar que james se puede fijar en algunas de ustedes y apoyo a YEMEK despues de todo tiene toda la razon

  1214. Blanca Morales Dice:

    HAAA cres que eres mayor fan (dulce) de J.M OK…. :P creo que todo lo que dices de que lo que somos (LAS FAN’S) EN VERDAD me das un ASCO y te digo que tu tambien eres una mierda estupida que eres ASI y QUE NO TE BURLES SIIII y tambien a tu (APOYADORA) YEMEK JAJAJAJA.. pues yo no lo creooo que tiene toda la RAZON.

  1215. diana Dice:




  1217. Valentina De Malik Styles Tomlinson Payne Horan: Vas Happenin Dice:

    Antes??? Pro si cuándo tenia el kbllo largo se veía bn feo y lo digo xke yo veo la serie,no soy su fan pro tampoco odio como actuan pro aveces digo cosas malas d ellos cuándo las rushers insultan a 1D,no creo ke les hayamos hecho algo como para ke nos y los odien asi

  1218. mariiana Dice:

    bueno chicas soy una verdadera fan de james maslow pero busquen en internet si james maslow es gay si o no y delen en yahoo respuestas y veran los feos comentarios q le ponen a james maslow yo no estoy de acuerdo cn esos comentarios

  1219. tania Dice:

    escuchenme James es mio yo se todo sobre el y yo si soy la fan numero 1 ustedes solo se ilusionan y yo lo conocere primero
    i love you james vengan primero a morelia guapisimo

  1220. sofia Dice:


  1221. mili Dice:

    hola james sos hermoso te amoooo!!! a vos a Carlos y a Kendall son hermosos BIG TIME RUSH en especial vos en mi piesa tengo un monton de posters de ustedes,demi lovato,selena gomez y violetta quisiera tener de victoria justice TE AMOOOOO JAMES

  1222. monsiii Dice:

    somos igual con jemes david maslow ijijiji:$ a mi tambien me gusta el verde y mi perrita tuvo bebes y a uno le puse falco

  1223. irina ocaña Dice:

    eres tan lindo por forfa ven tu james , logan . kendall, y carlos a ecuador porfa no saben cuanto los amamos aqui tu eres tan perfec te comeria vivo y ademas eres tan sexy vay te espero por favor ven a ecuado btr es pequeño pero llenas y re pletas de rushers los amo big time rush muaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

  1224. irina ocaña Dice:

    eres sexy y tan perfecto plis ven a ecuador te estaremos esperando con mucho besos y abrazos te amo quisiera besar y violarte no pienses mal solo te quiero como una rusher te amooooooooooooooooooooooooooooo

  1225. nashly marie Dice:

    eres lindo wooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo me impresionas

  1226. rusherita Dice:


  1227. valeria Sanchez Dice:

    Ya veo lo mucho que saben de el. Para empezar es Carlos Pena, con N , no con ñ
    & segunda su perrito se llama Fox, no falco ¿ok?
    Y otra cosa..mientras estaba leyendo los comentarios vi uno que decia: que sin el BTR no tendria sentido ¡Malditas Rusheras! si amas a uno amas a los cuatro, eso no es ser Rusher, y luego insultando tambien a su novia Halston ¡porfavor! ¿que ganas con insultar? ¿si el la ama a ti que te importa? en mi opinion si el es feliz con ella yo tambien soy feliz

  1228. juliette Dice:

    Te amo james quiciera conocerte tengo 11 años y tenemos muchascosas parecidas a mi familia por ejemplo el color favorito de mi mama es el verde y el oroscopo de mi papa es cancer…… y q mal q me perdi tu concierto en panama el año pasado !!! Te ammmmmmmmmmmmmmmmmmmoooooo

  1229. glendy Herrera Dice:

    There are many people l admire, and you´re one of them, really admire your talent James. l wish you well.

  1230. maria fernanda Dice:

    james te amo te adoroestoy loca por ti camviaste muchisimo mi vida mi vida no tenia sentido nomas salio big time rush me encanto tu trabajo me encanto la actuasion q isieron todos pero en espesial la tuya te amo con locura y su pueden ojala y den un consierto en mexico

  1231. maria fernanda Dice:

    te amo con todo el alma <3 <3 <3 <3 <3 <3<3 <3 <3

  1232. liitzy Dice:

    enserio como me en cantaria conoser a james a los 4 pero enserio me encanta y muxxo mi amiga dise muxxas cosas sobre los 4 yo le digo ke no me importa en micasa tengo todos los discos de ustedes un poster cosas asi pero enserio que te amo mucho me en cantaria que yegaras a leer este mensaje aunke no lo kreo como kisiera ke vinieran adar un consierto aca en matamorross porke yo soy de aka pero es ovio ke no una ves yo le dije a mi mama ke el dia de mis xv a;os ke me permitiera konoserlos pero dise ke eso kostaria mas ke una xv pero enserio james si ves este mensaje porfabor contestalo <3 <3 james maslow

  1233. liitzy Dice:

    porfa contestalo,porsierto james mi hermana te adora bueno a logan mas pero adora alos 4 y logan cumple en el cumplea;os de mi ermana se llama dana belen bueno asta con desirte ke en mi facebook puse liitzy marroquin de maslow jaja pero eso es por ke te amo y muchooooooooooooooo

  1234. fabiola Dice:

    es Fox.. su perrito se llama Fox -.- no falco.. que fiasco son

  1235. gladys Dice:

    el es mi JAMES asi qk tranqkilas chikas x qk es mio

  1236. elsy Dice:

    su perrito de james se llama fox y no se llama falco y james tiene 22 años cumple el 16 de julio de 1990 y su nombre completo es james david maslow su estatura es de 1.86 m y sus ojos son de color verde avellana yo ya lo conoci y me dijo q soy unica y q le cai myu bien aparte de q es muy guapo tiene buenos sentimientos y eso es lo q no se fijan las demas q segun aman a james yo si lo amo de verdad <3

  1237. elsy Dice:

    si algunas no supieron q hubo un consierto de btr ya lo hubo y fue en el palacio de los deportes el dia 25 de septiembre del 2012 y estuvo increible

  1238. liitzy Dice:


  1239. anita Dice:

    naciste el mismo dia k yo

  1240. Tania Alejandra Dice:


  1241. Gabriela Dice:

    Saben a que hora cumple James ??? (/O\)

  1242. martu Dice:


  1243. martu Dice:


  1244. dulce rubio Dice:

    james eres super lindo espero que muy pronto vengan a Guatemala no dire que te amo porque no te conosco pero me encanta tu voz y tkm :)

  1245. dulce rubio Dice:

    a question where will your next concert?????????? I love you james

  1246. rosangelica Dice:

    los amos a todos son mi banda faborita los de searia q estubienran en mi 15
    los amo a todo mas de mil besos

  1247. nayeli rusher Dice:

    james maslow es judio ?

  1248. nayeli rusher Dice:

    respondanme x favor

  1249. katherin Dice:


  1250. dulce rubio Dice:

    hey una voz grave puede hacer agudos??????

  1251. ERICK Dice:


  1252. rusher :3 Dice:

    Yo lo AMO, soy Rusher ymi favorito de los 4 es Kendall :3, pero ahora estamos hablando de James, asi que, Amo a James desde la primera vez que lo vi <3 Me encanta como canta, actua, su SONRISA *-*

  1253. shaday Dice:

    jame i love

  1254. rusher de verdad Dice:

    SU perro de llama FOX no Falco ANimal

  1255. karelly Dice:

    james es muyyyyyyyyyyyyy feo y aparte las rushers son muy violentas odian a one direction por que saben que es mega super mejor que ellos
    me das asco james

  1256. jazmin mazlow Dice:

    james mi hermana se parecen mucho ati.
    le gustan mucho los caballos .

  1257. andrea aracely Dice:


  1258. gabriela Dice:

    karelly tu y tus wandirecsion ballanse ala var los trastes en ves de andar insultando a btr y ustedes tienen enbidia de que big taem rush son mejore que sus tonto e ivesiles one direcsion por que btr cantan 1000 veces mejor que sus estupidos y one direccion nunca estara al al cance de btr eeeeeee btr es mejor

  1259. Anónima Dice:

    Mira Pau si ati no te gusta James pues pa que carajo escribiste y chicas sin ofender no peleen por James el ni las conoce incluyéndome a mi mira James es guapo buen cantante gran actor en Big Time Rush pero a mi no me gusta como novio sino como amigo porque yo se que el tiene un gran corazón y podrá algún día ir a dar un concierto en donde cada una vive pero no peleen el no le gusta que peleen por el porque el un tendrá novia y no se pueden enojar porque el la eligió a esa chica que tengas mucha suerte en tu carrera James. <3

  1260. Anónima Dice:

    BTR espero que vengan a Puerto Rico porque nunca han venido para aca y me gustaria que venieran. <3

  1261. emili Dice:

    i love james maslow

  1262. yareli Dice:


  1263. sami Dice:

    te amoo james ojalaa vngan BTR a ecuador xq los amoo!! <3

  1264. anny Dice:

    YO TE AMOOOOO!!!!!

  1265. MaaRtiina Dice:

    Ahii James Como Loo Amoo ii El Perrito De Ell Se Llama FOX No Lo Que Dice Aii ¡¡¡IDIOTAAS!!!

    Aaah y Una Pregunta Para Las Mexicanas Que Significa Pendejas PorQue En Argentina Tiene Otro Sisnificado… Sii Mee Dicen Les Agradeceria Mucho :D


  1266. azahares Dice:

    wooo como me gustaria conoserlo es muy lindo y muy juapo siempre lo llevare en mi corazon <3 :3

  1267. angelica muñoz Dice:

    amo a todos de btr pero james se roba mi corazon fans el es mio nadie me lo quita

  1268. Ana Ruth Dice:

    El Perrito Que Tiene James Se Llama Fox! No Asi Como Dice Hai :P’
    Awwws’ Pero Amo a James…Bueno a Todos! Pero James Es Mi Devilidad <3 <3 <3

  1269. anny Dice:

    I LOVE YOU!!!

  1270. anny Dice:

    VOS ESTAS MMMUUUYYY EQUIVOCADA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

  1271. anny Dice:


  1272. anny Dice:


  1273. johana esteffany Dice:

    pues yo no vi mis galanes pero les deceo suerte en su concierto y bendiciones los amo como no tienen idea mmmm BIG TIME RUSH es lo mejor KENDALL eres super guapo y te notas realmente con cariño LOGAN wauu tu peinado me gusta y eres galan CARLOS wapo ya actrativo y JAMES eres genial tiens muertas a las niñas wauuu love a todos y un besote

  1274. lucy Dice:

    Hellow James i’m Lucy.
    My color faborit is Green
    my mucic faborit is Ameazing the BTR and i love you

  1275. ana sofia Dice:

    loveeeeeeeeeee james te amo mucho tiene mucha suerte tu novia al andar con tigo te deseo la mejor

    ¡LOVE! <3 <3

  1276. ana sofia Dice:



  1277. rocio de maslow Dice:

    james TE AMO MUCHISIMO eres el chico más lindo del mundo
    teamoteamoteamojamesjAMESJAMESJAMESjames james james jamesjames jamesjames teamoteamoteamoteamoteamo :*

  1278. valeria Dice:

    hay una parte falsa james tiene un cachorro de mascota llamado fox

  1279. jessica maslow chan Dice:

    james eres el mas guapo de todos y ami tambien me gusta el verde te amooooooooo?!!!!!!!

  1280. Sofia ^^ Dice:

    ¡Una cosa es falsa! James tiene un cachorro llamado Fox O_O

  1281. itzel Dice:

    yo tengo muchas ilusiones de conocerlo en persona

  1282. laura juliana Dice:

    Hermosoooo Miooooooooo Lo Amo Tantooo’

  1283. sandor Dice:

    james encerio contestas a tus fans dile a kendall que quiero conocerlo en persona y porfavor dile que conteste los chats que sus fans enviamos porfavor soy el super fan de todos ustedes big time rushers vengan a mexico los espero ´pero soy mas fan de KENDALL FRANCIS SMIDHT GERMAN

  1284. genesis Dice:

    te amo james eres muy guapo nadie sorportaria lo guapos q eres ba

  1285. Celia Love BTR Dice:

    He visto muchos comentarios de supuestas “Rushers” Y de verdad que me quedo sorprendida. Se que todos estan bien guapos pero tampoco es para que ofendan a las demas!! La que le caiga el sello que se lo ponga y si tiene alguna opinion respecto a mi comentario que me lo diga porque las Rushers de Puerto Rico somos muy unidas y SIEMPRE estamos en familia no diciendonos “pendejas” etc… Ademas Carlos,Logan,Kendall,James no son de ninguna de ustedes, ellos son de sus familias!! Ademas de eso queria decir que James esta bian guapoteeeeeeeeee *-*

  1286. luci Dice:


  1287. malissa Dice:

    yo te odio pero yo amo a longan muchoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo de aqui al cielo

  1288. wuendy yhanet Dice:

    hola james como es tas lamento no aberte felisitado el dia de tu cumlpe pero es que me fui con mis primas bueno adios es pero que te la haigas pasado super en tu cumple adeios james maslow

  1289. frida retamoa granados Dice:

    te amo james soi tu fan numero 1 qisiera conosert aunk tengamos ppocas cosas en comun tamo soi 100000 x100 rusher amo tu banda besosss

  1290. Liz Dice:

    James Maslow

  1291. natalia Dice:

    I love james maslow te amo soy tu fan me encanta tu musica te amo♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥♥ I LOVE JAMES MASLOW

  1292. Juanii Dice:

    Jamessss te amooo sos el chabon mas lindoo que hay en el mundooooo sos uno de los mas grosos de BTR y porsupuesto el mas lindo te qeria decir q estas ree bueno y q te ree doy jajaja besoossos

  1293. Liz Dice:


  1294. genesis Dice:

    que guapo que es james maslow y que suerte que es de familia cercana y lo amo tanto nunca en mi vida lo voy a olvidar

  1295. alanis Dice:

    q hermoso eres james tenemos una quimica me gusta el color verde mi banda favorita es maron 5 te amo chau

  1296. Liz Dice:

    Te Amoooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo