Conoce a Lion

Grupo Lion
El actor y cantante Yago Muñoz ha seguido por su cuenta después de ser parte de la famosa agrupación EME15 y viene con todo ahora con Lion, su nueva banda. Lion surgió de un primer proyecto llamado Demaría, donde participaba Yago y Miky Mendoza, quienes al lado de Ivan Lopto y Pope Lopto formaron esta nueva propuesta musical.

Yago da muestra de su talento esta ocasión con un sonido diferente y fresco, un poco más orientado el rock pop, con el cual intentará seguir contando con el apoyo de sus seguidores y conseguir el aplauso del público. Su primer sencillo “Irreversible” ya está sonando en los medios y no pueden dejar de escucharlo.

Lion ya está trabajando duro en el estudio para el lanzamiento de su primer disco, el cual se espera que esté listo en fechas próximas para que pueda ser disfrutando por todos y sean parte de este nuevo comienzo en la carrera de Yago. Deben estar pendientes y esperar nuevas noticias de esta agrupación que promete mucho. ¿Creen que tenga éxito?



5 comentarios sobre “Conoce a Lion

  1. OMG!!! no lo puedo creer, neta su primer disco!!! woooow no puedo esperar para que lo saquen y yo lo pueda comprar.. seré la primera en comparar el cd y claro como siempre apoyar a Yago! LO AMOOOO es tan guapo y no solo tendrán éxito si no que también el apoyo de todas las #Líoners y #Yagonaticas.

  2. ovio va a tener exito yo voy a comprar mi cd apenas salga son los mejores despues de paulina goto y eme 15 te amo yago porfa vengan a mendoza con eme 15 y lion abre el concierto guuuuaaaaaaauuuuuuuuu

Deja un comentario